![]() | This is an archive of past discussions. Do not edit the contents of this page. If you wish to start a new discussion or revive an old one, please do so on the current talk page. |
Archive 1 | Archive 2 | Archive 3 | Archive 4 | Archive 5 | → | Archive 10 |
Could someone please have a look at the requested move of Gene synthesis → Synthetic DNA (see Talk:Gene synthesis#Requested move)? I'm thinking of making additional changes to the article once the location is determined, but can't move it myself. Mikael Häggström ( talk) 04:23, 25 May 2010 (UTC)
Help needed. An anon has deleted 90% of this article, along with most of the references, the marked the rest for deletion. The article has plenty of problems but WAS sourced beyond the initiator's papers. I'm just a page-watcher on this tho I did try to clarify and wikify a little a few months ago. Please see article discussion pageI'll revert the hatchet job but I don't have the time, journal access, or expertise to broaden the article. Dankarl ( talk) 22:22, 27 May 2010 (UTC)
Hi, I'm not sure what the policy on pages for genes and their protein products is, but there seems to be a page each dedicated to PRG4 (the gene) and lubricin (the protein product). Is this OK, or do they need to be merged in some way? Ka Faraq Gatri ( talk) 22:27, 27 May 2010 (UTC)
Hi, I have created some time ago some lists about restriction enzyme cutting sites:
I don't know if it would be useful to add these pages to this WikiProject. What should I do? Just to add the banner? anything else?
The first article ( List of restriction enzyme cutting sites: A) is completed, with the most available higher impact references added, and 8-10 isoschizomers/enzyme added too. I am working in the rest ones, day by day. Flakinho ( talk) 14:28, 28 May 2010 (UTC)
what are the four things connected when a protein is formed in translation? —Preceding unsigned comment added by 97.89.161.119 ( talk) 02:05, 2 June 2010 (UTC)
Crizotinib
The new-ish Wikipedian ScienceRulz2012 ( talk · contribs) has created the article Crizotinib, and asked for my help in developing it.
I think it is within the remit of this project group, so I added the project on the talk page, with an initial assessment of start class/low priority. [4]
I would be very grateful if anyone could look at the article, possibly change the assessment, and make comments on the talk page. Best, Chzz ► 16:28, 10 June 2010 (UTC)
The article on Major urinary proteins is at FAC here. This is probably the most relevant community for the article, so I figured I'd let folks know it's up for review. Emw ( talk) 00:06, 11 June 2010 (UTC)
See eukaryotic gene example. Surely an arbitrary example is not an appropriate topic for an article? Should this be edited and moved to eukaryotic gene or merged somewhere or.. ? mgiganteus1 ( talk) 01:07, 9 June 2010 (UTC)
The FAC nomination for Homologous recombination has been up for about a week and a half, and is in need of further review. As it is a major mechanism of DNA repair and genetic diversification, the subject is one of WikiProject MCB's "High Importance" articles. I'd greatly appreciate any input! Emw ( talk) 00:49, 24 June 2010 (UTC)
Science isn't my area which is why I'm not inclined to do anything about this myself but it seems to me that these two articles are pretty much identical and that one should be turned into a redirect for the other. -- *Kat* ( talk) 14:38, 12 July 2010 (UTC)
I have, again, been doing some major tidying of microscopy related articles, particularly microscope, optical microscope and some smaller edits on digital microscope, USB microscope, stereo microscope, and immunofluorescence. I have been trying to remove strong biases in the articles (most had a bias towards very old and very new technology) and split pages into more logical chunks (for example stereo microscope is now a standalone article). I would greatly appreciate it if anyone could take a quick look at my changes and let me know about any big mistakes or omissions!
I am also trying to create some good example pictures of light microscopy illumination techniques, what do you think of these?
- Zephyris Talk 08:55, 13 July 2010 (UTC)
Hi, everyone. I'm proposing to recategorise all hormones. My idea is to make the subcategories more distinct from each other, and to give more options to someone searching through the categories. Looking for input! - Richard Cavell ( talk) 02:07, 16 July 2010 (UTC)
I recently took some nice DIC microscopy images (or I believe them to be nice anyway) that I took at an internship and I own all the rights to the images...those that I have uploaded have been licenced anyhow. I took a lot of movies which showed vesicles moving about, a cell capturing two gold nanorods and internalizing them, cells thickening and thinning, intercellular connection formation and destruction and also just aesthetically pleasing images? Someone tell me where I could put them or where they might be useful. I particularly like a set of images which showed the fine focal plane precision of DIC (cells visible and in focus in all of the images, but cytoneme and filopodia-like connections disappeared and appeared depending on their focal plane). John Riemann Soong ( talk) 01:43, 19 August 2010 (UTC)
this discussion has been going on for three years. Anyone want to do the deed? Totnesmartin ( talk) 13:33, 23 September 2010 (UTC)
Dear MCBers, I have two quick announcements regarding the Gene Wiki project. First, the NIH has recently funded a grant proposal in my group focused on the Gene Wiki. Some of the work will be on improving the gene pages themselves, and others will be focused on mining the pages for useful data. You can read some more in our blog post. Details are a bit sparse, but only because I haven’t gotten more organized yet. We definitely want to engage as many people as are interested! Feel free to ask any questions here or via email...
Second, Ben Good and I will be presenting on our efforts in a webinar next week (Oct 6, 10AM Pacific) for the NCBO. Anyone is welcome to join in to listen what we’ve been up to. And of course, profuse acknowledgments always go out to the editors who really make the Gene Wiki project successful. Cheers, AndrewGNF ( talk) 00:57, 30 September 2010 (UTC)
Hello,
Could someone take a look at
Polycentric chromosome? It's a new stub. I suspect, from a quick google search, that the original editor may have the wrong end of the stick and the definition could well be incorrect. I'm also not sure whether the subject warrants an entire article or whether it would be best off merged with
Chromosome or maybe
Chromosome abnormality.
Ka Faraq Gatri (
talk) 22:37, 11 October 2010 (UTC)
A disagreement on whether it is appropriate to mention the "God Gene" in the Vesicular monoamine transporter 2 article has developed. I would appreciate input from third parties. Thanks. Boghog ( talk) 04:18, 18 October 2010 (UTC)
There are three outstanding "expert assistance" requests related to MCB on the list:
{{ Expert-subject}} sometimes gets spammed to articles that just need some attention from anybody, but if someone here could please look over these three and figure out what help, if any, was wanted -- and to either fix the articles or to remove the tags, if you can't figure out what's going on -- I'd appreciate it. WhatamIdoing ( talk) 18:01, 18 October 2010 (UTC)
Please contribute to the discussion. Uncle G ( talk) 23:05, 18 October 2010 (UTC)
Could someone with some knowledge of the field check over Pseudo amino acid composition and Low-frequency collective motion in proteins and DNA which were written by two related SPAs, to make sure they are important enough to merit their own articles and whether it is correct to give so much importance to Kuo-Chen Chou's name and work? All of Low-frequency internal ( talk · contribs)'s edits could probably do with being closely scrutinised in fact. Cheers Smartse ( talk) 19:19, 19 October 2010 (UTC)
Several participants in this WikiProject have advanced knowledge of genetics, and I'd like to suggest a way to contribute your knowledge of the professional literature for improving articles all over Wikipedia. Wikipedians reading or editing articles are welcome to look at a bibliography of Anthropology and Human Biology Citations, posted for the use of all Wikipedians who have occasion to edit articles on human genetics and related issues. I happen to have circulating access to a huge academic research library at a university with an active research program in these issues (and to another library that is one of the ten largest public library systems in the United States) and have been researching these issues sporadically since 1989. You can help other Wikipedians by suggesting new sources through comments on that page. It will be extremely helpful for articles on human genetics to edit them according to the Wikipedia standards for reliable sources for medicine-related articles, as it is important to get these issues as well verified as possible. -- WeijiBaikeBianji ( talk) 19:46, 27 October 2010 (UTC)
Please contribute to the discussion. Uncle G ( talk) 01:54, 29 October 2010 (UTC)
Our antibiotic article currently says that they only are only antibacterial, however I just made a stub about a family of antibiotics ( peptaibols) that are antifungal and this usage also appears to apply to other antibiotics like clotrimazole (see this paper). Should the antibiotic article be changed in account of this? (The article is also written from a totally human perspective, something I've bought up elsewhere previously, as it only discusses their use as drugs, rather than by microbes in nature.) Smartse ( talk) 17:37, 29 October 2010 (UTC)
It seems that WP:MCB is not feeling too communicative.
This graph shows the number of edits in the four WP:MCB talk pages, it would be great if it were actually of articles in WP:MCB but that would take more time to do, but I'd assume that the traffic on the WP reflects it's articles (unless everyone is more efficient). Note: The graph has been subjected to
SMA-5.
Basically, WP:MCB's hayday was in 2006 when Help and Announcements were split from Discussion and up to last year it was gathering strength, with a nasty dip between Sept-Dec 08, but now it is drammatically loosing edits.
Two situations:
I am aware there a similar WP-wide effect, but not sure if it is this pronounced. If it is the latter, what can be done? The only thing I can think of is to make it more rewarding for editors and making a MCB barnstar and encorage its use, maybe? (when I give them out I give the bio one but I do not think it is quite the right one) -- Squidonius ( talk) 21:49, 20 September 2010 (UTC)
![]() |
The Molecular Biology Star | |
Not the most valuable award, but some recognition is better than none! |
-- Squidonius ( talk) 20:46, 22 September 2010 (UTC)
To verify the hypothesis that all the edits go on the background, aka the gnome hypothesis :) , I wrote a script to download and analyse all the MCB pages.
The decrease is quite marginal (the data is unmodified, while the black line is a 12-month period moving average (e.i. smoothed out version), whereas the previous graph had relative few edits per month so more noisy so was smoothed), so here is a more succinct pictograph (why a pictograph? It makes the data look more believable in the popular press!), showing there is a 15% drop from last year. I am talking about an absolute difference of 30k edits so any stats will give infinitesimal p-values.
. So there are less edits, but it is not as drammatic as first predicted and it started actually last year... Shame, I quite liked the Gnome hypothesis. The data shows some periodicity, when I have more time I'll do a Furrier analysis to see if it has to do with Northern hemisphere university term times. However, I think there is the Bot hypothesis, in which bots have done most edits, although I have had trouble automatically filtering out bot edits (upto a 3 fold underestimate), which account for over 1/7th of all edits... Parenthetically, edits and editors, as expected, form a power law distribution with a kink caused by bots.
-- Squidonius ( talk) 21:13, 3 October 2010 (UTC)
The decrease is caused mostly by bots: Bot edits have dropped by 65% from last year (October-Dec 2010 corrected) and 75% from 2008, whereas human edits have dropped by 5% per annum since 2010 (gods dropped by 45%), so not so dire after all, but still not good. (apropos, I think I'll bring this analysis somewhere else and stop spamming.) -- Squidonius ( talk) 08:11, 4 October 2010 (UTC)
I spent an hour today playing around with the data and got some interesting results regarding the periodicity of edits across the day (I was surprised as I though that the Euro/US time zones would cancel each out), week (monday procrastination) and year (dip in the summer), any handwaving ideas and hypotheses welcome. As I do not want to spam, I have made a page on my userpage with the graphs [ [5]] and one day I'll get round to finishing it (promise). -- Squidonius ( talk) 23:34, 1 November 2010 (UTC)
I have managed to get a created article and an expansion on the "Did You Know..." list, namely Fluorescent glucose biosensors and Mycoplasma laboratorium, which is always quite fun (and terribly time consuming). I the process I was told by Smartse about the existence of these templates: {{ cite pmid}}, {{ cite doi}} and {{ cite jstor}} which automatically add a full citation and would have saved me uptillions of mouse clicks. So I though I pass the word! A page I have found useful is WP:FOOT, a how-to for references. I have not found a good way of inserting endnote into wikipedia, doi appart). -- Squidonius ( talk) 19:37, 27 October 2010 (UTC)
Hi guys,
It'd be great if you could take a look at Wikipedia:Articles for deletion/Porins and LPS. Ka Faraq Gatri ( talk) 12:36, 6 November 2010 (UTC)
Version 0.8 is a collection of Wikipedia articles selected by the Wikipedia 1.0 team for offline release on USB key, DVD and mobile phone. Articles were selected based on their assessed importance and quality, then article versions (revisionIDs) were chosen for trustworthiness (freedom from vandalism) using an adaptation of the WikiTrust algorithm.
We would like to ask you to review the MCB articles and revisionIDs we have chosen. Selected articles are marked with a diamond symbol (♦) to the right of each article, and this symbol links to the selected version of each article. If you believe we have included or excluded articles inappropriately, please contact us at Wikipedia talk:Version 0.8 with the details. You may wish to look at your WikiProject's articles with cleanup tags and try to improve any that need work; if you do, please give us the new revisionID at Wikipedia talk:Version 0.8. We would like to complete this consultation period by midnight UTC on Sunday, November 14th.
We have greatly streamlined the process since the Version 0.7 release, so we aim to have the collection ready for distribution by the end of November, 2010. As a result, we are planning to distribute the collection much more widely, while continuing to work with groups such as One Laptop per Child and Wikipedia for Schools to extend the reach of Wikipedia worldwide. Please help us, with your WikiProject's feedback!
If you have already provided feedback, we deeply appreciate it. For the Wikipedia 1.0 editorial team, SelectionBot 16:34, 6 November 2010 (UTC)
A new user that I am trying to help get acquainted and familiar with Wikipedia has worked on this article and asked me how it looks, if everything is formatted right (like the infobox he added). Would it be possible for someone to take a look at it? Thanks in advance. AaronY ( talk) 17:23, 12 November 2010 (UTC)
I just found doi: 10.1038/342609a0 and was wondering if we have an article to which gene shears could redirect to? I think it should go to hammerhead ribozyme but just want to check, as that article doesn't mention them and I've never heard of them before. SmartSE ( talk) 11:23, 18 November 2010 (UTC)
(Just a courtesy note.) There has been some discussion recently about whether Wikipedia:Scientific citation guidelines needs to be updated to reflect current practice. This wikiproject is one of the projects that had signed on to this guideline in the past. If you have any comments or concerns about the guideline, please feel free to comment at Wikipedia talk:Scientific citation guidelines. If this project no longer wants to be named on the guideline page, you may remove yourself from the list at the top of the guideline page. — Carl ( CBM · talk) 18:56, 22 November 2010 (UTC)
The article about the bacterium with the genome which was synthesised by the JCVI institute is in Mycoplasma laboratorium, which is a different organism but work of the same group. Should be split? if so, what name should it have? Mycoplasma genitalium JCVI-1.0? Is the name Mycoplasma laboratorium the best choice for the page name? (see discussion) -- Squidonius ( talk) 21:55, 1 December 2010 (UTC)
There are a number of articles concerning gene/proteins where there is no human ortholog. Some of these articles transclude the {{ infobox protein}} template. This is less than ideal since many of the external links are to human databases (e.g., HGNCid and OMIM) whereas others are "hard wired" to human data (e.g., RefSeq and Chromosome). In order to overcome this limitation, I created a new {{ infobox nonhuman protein}} template in which the RefSeq and Chromosome link now should work with any species. In addition, two additional parameters, organism and TaxID have been added so that the species may be specified. An example of the template in use may be found in a recently created uterine serpin article. Comments and suggestion for improving the {{ infobox nonhuman protein}} template are welcome.
I also wanted to acknowledge new MCB WikiProject member User:Ufpete for the great job he did in creating the uterine serpin article! Boghog ( talk) 07:41, 2 December 2010 (UTC)
Hi. This article was tagged as a suspected copyvio; I don't find any evidence to support that, but it looks like a potential content fork of Meiosis. It had been tagged for merger, but no conversation opened on the subject. I went ahead and redirected the article, but I'm hoping to get some review from somebody who can determine if there is valid content to be merged or if it can/should be turned into a stand-alone article. I'd be grateful if somebody with the background for that would take a shot at it. :) -- Moonriddengirl (talk) 22:55, 21 November 2010 (UTC)
A request for comment has been made at the above link. Your input is welcome. Boghog ( talk) 23:15, 6 December 2010 (UTC)
One focuses on the biology/enzymology, other on the chemistry, of apparently the same actual enzyme-class. Seems ripe for merge/redirect, but which should be the actual article? Is there an MCB naming guideline for enzymes, or anyone have a feel for the "more common" name for this one? DMacks ( talk) 14:08, 12 December 2010 (UTC)
I stumbled upon it while doing cleanup, and it strikes me as something very odd to write. Headbomb { talk / contribs / physics / books} 04:01, 31 December 2010 (UTC)
The protein C article is currently undergoing a good article review (see Talk:Protein_C/GA1). Your input is welcome. Boghog ( talk) 22:01, 3 January 2011 (UTC)
Fellow WP:MCBers. I've recently been speaking with a (responsible) New York based journalist who is working on a story on the people and motivations behind the biological content on Wikipedia. She is attending the upcoming American Association for the Advancement of Science meeting and was wondering whether any Wikipedians were going. If you are, she would like to meet with you. Leave me a message or email me and I can put you in touch with her. Her request is as follows:
Rockpocke t 10:18, 14 January 2011 (UTC)
I've removed the diagram on the right from six articles, as its accuracy has been contested. Help from knowledgeable contributors would be appreciated. Please keep discussion consolidated at Talk:Cytotoxic T cell#Misleading Diagram. Adrian J. Hunter( talk• contribs) 13:12, 22 January 2011 (UTC)
I've worked a little bit on Mechanism section. I would be grateful if anybody could go through the text and check style, comprehensiveness, grammar... I would like to push it to FA or GA status but biggest problem are missing citations. If you know any article which can be cited there, please do so. Thanks. Mashin6 ( talk) 00:30, 28 January 2011 (UTC)
Hello MCB members! I came across the article " Lipid raft" and found that it did not meet GA criteria. I have asked for a reassessment. However, because there is no "GA review page", I suspect that user:WIstutts (who labeled the article "GA class") may have classified it without knowing of the GA review process. This user appears to be no longer active.
I would appreciate any input on this matter. I am not sure what to do in this situation. -- Tea with toast (talk) 22:06, 3 February 2011 (UTC)
There's an RfC at Template talk:Taxobox colour#In light of the luminosity increase. Please share your thoughts there. Bob the WikipediaN ( talk • contribs) 15:53, 7 February 2011 (UTC)
Can someone here who actually knows the field (unlike myself) take a look at Small nucleolar RNA SNORA64/SNORA10 family? I found this entry while working on Great Backlog Drive. Looking as an outsider, it seems odd to me that this one entry, out of all of the small nucleolar RNA articles, has a really unusual name. Is there a good reason for SNORA64 and SNORA10 to be grouped together into the same article? I understand that they are homologous, but it seems like they should still have separate entries. The external links don't help (the Rfam page is mostly just a copy of this WP article, and the snoRNAbase entries both say "Nothing was found." Before I do the cleanup that the page needs, I'd like to confirm whether or not this should actually be a single article, and if this is the correct. Thanks for your expert help! Qwyrxian ( talk) 05:50, 5 February 2011 (UTC)
ACA10 GGTCTCTCAGCTCCGCTTAACCACACGGGTCCAGTGTGTGCTTGGCGTGTTTTCAGGGAG ACA64 -----GTTGGTTGAAAATCGCCCC-CGGCTTTGGCCGTGGCCGCGGGTGAGATTCGGCGC * * * * ** * *** * * ** * *** * ** ........(((((.((((.(((.((((.(((((((....))))))).))))....))))) ACA10 GCAGAGAAA--GGCTCTCCTAATGCACGACAGACCCGCCCAGAATGGCCTCTCTGTTCCT ACA64 CCAGAGCCCCCGGGGGCCTCAGCTCACCGCGCGCTGCCCCATG--TGCGGCGGTGAAACC ***** ** * * *** * * **** ** * ** * )).)))))....(((((((((..(((((((.(((............))))))))))...) ACA10 AGGAGTGCGACAATT ACA64 CAGGCCCCGACAGGC * ***** )))))))).......
Hi everyone, I think epitope mapping should be divided into T cell epitope mapping and B cell epitope mapping. ---- Annie D. — Preceding unsigned comment added by AnnieDWiki ( talk • contribs) 14:16, 13 February 2011 (UTC)
I have a difficulty with the way this entire section has been handled. The people who use Wikipedia aren't just scientists. Housewives and high school students and writers use this as a reference source too. They have no idea what you're talking about when you start right out with the high end information. I'm a computer engineer and writer. I have no training in biology whatsoever. ...even managed to miss high school biology. I came here to get information about triticale. I'm well read and know quite a bit about the subject already. I'm also pretty intelligent. With all that I couldn't manage to get any information out of that page. All the sentences were for those people "in the know". A reference page that can only be used by those people who already know the information is no use to anyone. At least lighten up on the first paragraph. Give us lay people a break! — Preceding unsigned comment added by Sack36 ( talk • contribs) 11:13, 30 January 2011 (UTC)
Sigh. I consider this quirk rather extensive but I will give you a list of the articles I looked at most recently:
By the way, I'd like to commend you all for the Quinoa article. Very clear and informative with very little geek speak. deepsack ( talk) 13:08, 31 January 2011 (UTC)
Thanks, Ehamberg. It looks great. I've added it to the article. WhatamIdoing ( talk) 18:05, 15 February 2011 (UTC)
Someone familiar with cloning might want to take a look at these articles. There is a merge proposal and some cleanup in tone and referencing is needed. Regards, P. D. Cook Talk to me! 19:58, 24 February 2011 (UTC)
Hi—another question from the editor entirely ignorant of molbio info. The reason I'm editing these articles is because I'm trying to work on the backlog of pages with Stylistic problems, which a number of snoRNA pages are marked with (usually with {{jargon}}</jargon>). While looking for models to follow, I saw that all of the SNORA articles use at the bottom the navigational template <nowiki>{{Small nucleolar RNA SNORA}}. This template contains not only SNORA snoRNA, but also a variety of others (J, MB, etc.). However, articles other than SNORA articles don't have this template. It seems to me that an article like Small nucleolar RNA J33, which is listed on and linked in {{Small nucleolar RNA SNORA}} should also have that template. Alternatively, it seems like we could remove the non-snoRNA articles from that template. Does that make sense? It's odd to me to see a navigational template that has links to articles that do not themselves use that template. Is there some specific reason for this? Do you believe the template should be added to all of the articles it links to (and, if so, possibly renamed?), or should the other articles be removed from the template.
Thanks again for bearing with a clear non-expert. Qwyrxian ( talk) 05:09, 18 February 2011 (UTC)
These articles
Have empty references - the PMID id is there in the ref name (where I've looked)but the content is null - an HTML comment and some markup.
Secondly reading one of the references I found we didn't have an article on amino acid response - so I made a little stub. For reasons I won't go into I think this is a very important area of cell biology - unfortunately my ignorance in this area is somewhat staggering. It would be fantastic if we had a decent article (or set of articles) that lad out the current state of knowledge of the pathways for each deficiency, and from ATF4 onwards.
Good to have them fixed.
Rich
Farmbrough, 00:32, 4 March 2011 (UTC).
I have recently been looking at the referral stats for a number of biological databases to find out how much traffic Wikipedia is generating for them. I contacted the nice people at the RCSB PDB and they tell me that 9% of referrals (not including direct traffic from bookmarks etc) come from Wikipedia. This is a cool statistic! Andreas at PDB tells me that on average visitors to PDB from Wikipedia stay for less time than others. But one final statistic that Andreas would like suggestions about is why, "in contrast to all other site trends we have fewer wikipedia referrals this year compared to last year. Perhaps something got changed in the presentation of links back to us, or wikipedia usage is dropping?". Does anyone have any insight into this? Thanks Alexbateman ( talk) 13:23, 28 February 2011 (UTC)
{{
cite journal}}
: Explicit use of et al. in: |author=
(
help); Unknown parameter |month=
ignored (
help)CS1 maint: multiple names: authors list (
link)
Everyone agree that PDB is a great resource. Yes, it was significantly improved. Please add links to PDB anywere, and everyone will be very happy. But no one should replace good links to other sites by links to PDB. This is per WP:NPOV policy, broadly speaking. Of course one might argue that PDBsum is redundant and therefore should be replaced. However, this is not the case: PDBsum has a graphical view of protein sequence with secondary structure, a graphical interface to Procheck, different and better in certain aspects interfaces to ligands, substrates and subunits, and other features which are not present in main PDB portal or which are made very differently. What would you tell about a scientist who replaces references to publications of his competitors by references to his own publications? Doing so would be also against NPOV policy. Hodja Nasreddin ( talk) 14:27, 5 March 2011 (UTC)
Molecular and Cellular Biology WikiProject members, please, this is being discussed at:
Wikipedia:Articles for deletion/Names of small numbers http://en.wikipedia.org/wiki/Wikipedia:Articles_for_deletion/Names_of_small_numbers#Names_of_small_numbers
Thank you. Pandelver ( talk) 00:17, 12 March 2011 (UTC)
In wikipedia if bacteria cause a disease they are well documented, otherwise they are a red link. Escherichia coli has an extensive review of its pathogenic strains and a malformed Biotech section. I added a section on diversity and created a new page called ( Escherichia coli (molecular biology), where I have written about the history of K-12 and B strains but have not mentioned molecular cloning, unfortunately I will not have any editing time in the near future, so if anyone wants to add a section please do! -- Squidonius ( talk) 13:47, 12 March 2011 (UTC)
Over at BRCA2, a mutation "999del5" is identified as truncating the protein. What does the "5" mean here? I know what "999delA" would mean, but I don't think I've seen a number used, and I can't find the answer. WhatamIdoing ( talk) 20:32, 17 March 2011 (UTC)
Why are em dashes used on List of EC numbers (EC 2) and many of the templates at the bottom of that page? Sources may use en dashes, but no-one uses an em dash within a word. These shouldn't even be redirects. I thought about moving the em-dash redirects to en dashes, but there are so many of them that I was worried I might gunk things up. Am I missing something? Also, aren't many of these ambiguous with the use of only hyphens? — kwami ( talk) 22:50, 18 March 2011 (UTC)
{{
cite journal}}
: Unknown parameter |month=
ignored (
help)), there are 5268 Enzyme Commission entries (record = "ID"). In this particular file, en/em dashes in the accepted name (record = "DE") are represented by a double hyphen "--". There are 226 entries with a double hyphen (see
User:Boghog/Sandbox5 for wiki links, two links per line, left link is based on the enzyme name where the double hyphen has been replaced with a single hyphen, "--" → "-", right link double hyphen has been replaced with an em dash, "--" → "—"). It appears that the articles names have em dashes replaced with hyphens whereas the proper enzyme names containing the em dashes are redirects. In my opinion, the direction of these redirects should be reversed.
Boghog (
talk) 10:38, 20 March 2011 (UTC)Database | Link | Symbol |
---|---|---|
EC number | [9] | — (em dash) |
IntEnz | [10] | — (em dash) |
BRENDA | [11] | - (hyphen) |
ExPASy | [12] | -- (double hyphen) |
KEGG | [13] | --- (triple hyphen) |
What would be the 2nd source using en dashes?
Double hyphens are the usual substitute for em dashes, and single hyphens the substitute for en dashes. (Triple hyphens are occasionally for em dashes used when double hyphens are used for en dashes.) So we have no evidence that anyone uses en dashes, while 3 and possibly 4 use em dashes. That's convincing. I'll start moving. — kwami ( talk) 21:47, 20 March 2011 (UTC)
I fixed a dozen or so links on your sandbox (parentheses and clipped names). — kwami ( talk) 22:03, 20 March 2011 (UTC)
Is there somewhere here discussing why (or if) the self replicating molecule only got created once? 82.137.72.133 ( talk) 10:51, 31 March 2011 (UTC) Yes, so I went and posted it on the link for queries at the top of the page and it came back here Ppeetteerr ( talk) 12:31, 4 April 2011 (UTC)
Hi,
Plindenbaum and I were editing some pages on Orthology databases. We discussed making a subcategory of Biological databases called something like Orthology databases. Of course one could subclassify the biological database articles more completely. Perhaps using the NAR database collection classification:
http://www.oxfordjournals.org/nar/database/c/
Has this been discussed before? Alexbateman ( talk) 08:22, 4 April 2011 (UTC)
Is there somewhere here about why (or if) the self replicating molecule only got created once? Ppeetteerr ( talk) 12:30, 4 April 2011 (UTC)
Is this self replication my answer? (joke) Ppeetteerr ( talk) 12:35, 4 April 2011 (UTC)
A number of editors, both named and anonymous, have been adding external links to GeneReviews. Usually this is from accounts that have never edited before and subsequently make no contributions. Instead of using the {{ Infobox disease}}, the editors use the external links section. Often, the links are only to very peripherally related conditions. Today it was 205.152.158.201 ( talk · contribs) who did a link adding spree.
Does anyone know why this is happening, and does everyone agree that these links are not always useful? What could we do to streamline these edits? Does anyone know the presumed person who is behind this? JFW | T@lk 17:04, 5 April 2011 (UTC)
I have no intention of chasing away the editor and would love to pin them down and turn them into content generators. JFW | T@lk 21:44, 5 April 2011 (UTC)
A new editor has asked for help at WP:FEEDBACK with Satellite cell (glial). It sounds like she's a student and has significantly expanded the article. If someone who knows a thing or two about this would please leave a note on the article's talk page at Talk:Satellite cell (glial), then I'm sure she would be grateful. WhatamIdoing ( talk) 19:26, 8 April 2011 (UTC)
Monopolin has been an orphan since the winter of 2009. "Mono" means "lonely" in Greek... Will spring 2011 bring hope? You can make a difference. walk victor falk talk 11:14, 10 April 2011 (UTC)
Hi all! I currently have peer reviews running for two articles I have worked on, DNA nanotechnology ( review page) and Nucleic acid design ( review page). I'd appreciate it if you could take a look and leave any feedback you could give. Thanks! Antony–22 ( talk⁄ contribs) 01:42, 19 April 2011 (UTC)
Just a quick pointer that there is an interesting thread over at WikiProject Chemicals about enabling Jmol on wikipedia. This is something that might be interesting for many pages here, too. [14] -- Andreas ( talk) 04:08, 8 April 2011 (UTC)
Hi everyone,
My biological clocks class is working on a few circadian biology articles. We've submitted cryptochrome ( create review page) and Candolle ( create review page) at GAN, but so far no reviewers have shown up; if one of you could help with a review, that would be great. We're also tackling the following articles:
We haven't set up formal peer reviews for the latter articles, so the talk pages for the articles are fine for feedback. General feedback for the class can go here or on my talk page. Thanks! C1ock122 ( talk) 21:17, 19 April 2011 (UTC)
Bleb is a (the) member of the non-existent category
Category:Cell motility. I'm not sure it belongs there, however I am also inclined to think that would be a useful category. I leave it to the experts.
Rich
Farmbrough, 23:48, 24 April 2011 (UTC).
I wanted to know the consensus for what headers and sections a protein or gene article should have and what are the preferred orders, but both wp:Manual of style (protein articles) and wp:Manual of style (gene articles) are currently red at this time of posting. They should be made blue, either by redirect or by article creation. Mikael Häggström ( talk) 06:10, 15 May 2011 (UTC)
A major issue that needs a note in any
wp:Manual of style (protein article) is in handling Interactions-sections, such as that found in
Rb#Interactions or
BRCA1#Interactions.
A previous suggestion on splitting them to separate articles was apparently not feasible. I think, however, that the problem rather is the current presentation of them as tediously long lists of proteins. After all, it's not the protein interaction itself that is notable, but rather any effect of it, such as stimulation or inhibition of protein activity - and such effects should be given in the Wikipedia article rather than simply referring to external sources like a
collection of external links (which Wikipedia should not be). Therefore, I suggest adding the guideline that a protein interaction is notable for inclusion only when there's a comment on any effects of the interaction, such as specific stimulation or inhibition of protein activity, and may otherwise be deleted. The comprehensive lists can still be found in external (and more updated) databases for this purpose, such as
CPDB.
Mikael Häggström (
talk) 06:55, 15 May 2011 (UTC)
Hi, just came across this.. are these two articles about the same thing? Sorry I didn't know where else to ask, I'm not knowledgeable on this subject. -- œ ™ 16:59, 15 May 2011 (UTC)
I'd hold off on a merger. These may need dab hat notes. Zooid (zoöid) /ˈzoʊ.ɔɪd/ and zoid (zoïd) /ˈzoʊ.ɪd/ are old synonyms, dating from the mid 19th century at the latest; it's quite possible that they have been formally distributed among the two meanings they were used for.
The broad historical usage is attested in the OED, which says of zooid:
It may well be that that early use has now been made specific to zoid.
BTW, there's also zoon /ˈzoʊ.ɒn/, pl. zoa, which is,
— kwami ( talk) 00:17, 16 May 2011 (UTC)
The article Moonlighting protein was created recently as part of a school project. I started applying wiki love but just discovered the Gene sharing article which covers the same topic. Which name is better? Anyone want to help merge these? Discussion at Talk:Moonlighting protein. Quarl ( talk) 06:14, 17 April 2011 (UTC)
Someone has just pointed out a nice resource called FactorBook to me: http://zhome.umassmed.edu/elgg/ I suggested to the authors that they add links to their resource from the relevant Wikipedia articles. I already did one example for them at the IRF4 article. Does that sound reasonable? Alexbateman ( talk) 07:24, 24 May 2011 (UTC)
There is a merge proposal at Talk:Α+β proteins that could do with some attention. Hans Adler 21:39, 25 May 2011 (UTC)
Hello all,
My circadian rhythms class has finished improving our selected circadian biology Wikipedia articles. We would appreciate if someone from the WikiProject could reassess the articles we've worked on (list here). C1ock122 ( talk) 19:36, 26 May 2011 (UTC)
I would appreciate some advice on the talk page of Acetyl-Coenzyme A acetyltransferase regarding some merges. Thanks. Cmcnicoll ( talk) 23:01, 31 May 2011 (UTC)
We are currently trying to breath new life into WikiProject Computational Biology. There is been quite a bit of overlap with this project and if there are any editors who are interested we could do with some help and advice in these early days. An important step currently is simply to identify Computational Biology articles and get them assessed so we can work out what needs working on. If you can spare a little time I'm sure we can give this project momentum enough to roll on its own. Thanks Alexbateman ( talk) 08:27, 9 June 2011 (UTC)
Hi, there's currently a requested move underway at Talk:SPINK5#Requested move which has been listed for a week and is yet to get any comments. I think the lack of comments is at least partially due to the technical aspect of the request (eg is it a protein or is it a gene? Hard for the lay person like myself to know). So, just wondering if any of this project's members who have any knowledge on the subject could add their thoughts to the requested move. Cheers, Jenks24 ( talk) 16:06, 22 June 2011 (UTC)
In Space, solar winds, mostly charged particles such as protons, penetrate living tissue and damage DNA, apparently some simple forms of life can survive on the outside of the International Space Station. But I don't know much about this, and you can read the ISS article and still be confused about the topic, I could sure use some help with it. I put some stuff in about tetrigrades? I can't even spell them, small invertebrate anyhow. Anyone got a spare 5 minutes ? Penyulap talk 15:12, 28 June 2011 (UTC)
I have nominated International Space Station for a featured article review here. Please join the discussion on whether this article meets featured article criteria. Articles are typically reviewed for two weeks. If substantial concerns are not addressed during the review period, the article will be moved to the Featured Article Removal Candidates list for a further period, where editors may declare "Keep" or "Delist" the article's featured status. The instructions for the review process are here.
{{ Chemformula}} has been nominated for deletion. 65.94.47.63 ( talk) 04:56, 30 June 2011 (UTC)
I thought I might notify that I have gone ahead and split E.coli, which now comprises:
Any help is appreciated in fixing all issues resulting from copy-edits. Thanks -- Squidonius ( talk) 07:20, 17 July 2011 (UTC)
Dear All,
I would like to add links to the FactorBook database which stores information about transcription factors particularly with respect to the ENCODE project. I have added a test link to IRF4, but have a list of a further 120 links that could be added. Here is the FactorBook pages for CTCF:
http://www.factorbook.org/mediawiki/index.php/CTCF
Do others feel it is appropriate to add these linkd to Wikipedia? Alexbateman ( talk) 10:15, 1 August 2011 (UTC)
Hello! We currently have two articles, Bacteriostat and Bacteriostatic agent, both apparently about the same subject, and neither of which have any supporting cites. I'd greatly appreciate it if someone knowledgeable could take a look at these, for fact-checking and possible merging. -- The Anome ( talk) 16:35, 3 August 2011 (UTC)
Dear MCB Project. It looks as though the PyMOL article still reflects a pre-Schrödinger version of said software. Does anyone here have the necessary familiarity with the Schrödinger version of PyMOL to update this article? It seems like there should be a way to do this while still preserving references to its open source development and the impact Warren DeLano had on the field. I(q) = User(q)· Talk(q) 01:40, 30 August 2011 (UTC)
Recently I've had some discussions with the editors at the journal Gene about how to encourage academics to improve Wikipedia articles on human genes. I started a discussion at the Village Pump. Please chime in there if you have any thoughts. Cheers, AndrewGNF ( talk) 22:34, 9 September 2011 (UTC)
The article Capping enzyme complex has been proposed for deletion. The proposed-deletion notice added to the article should explain why.
While all contributions to Wikipedia are appreciated, content or articles may be deleted for any of several reasons.
You may prevent the proposed deletion by removing the {{proposed deletion/dated}}
notice, but please explain why in your
edit summary or on
the article's talk page.
Please consider improving the article to address the issues raised. Removing {{proposed deletion/dated}}
will stop the
proposed deletion process, but other
deletion processes exist. In particular, the
speedy deletion process can result in deletion without discussion, and
articles for deletion allows discussion to reach
consensus for deletion.
Sławomir Biały (
talk) 20:20, 10 September 2011 (UTC)
We would like to solicit your feedback on a proposal from PLoS Computational Biology (PCB). The journal proposes to help establish new Wikipedia pages in the field of computational biology that are not currently covered, either at all, or exist only as a stub. The pages would be created in the Wikipedia sandbox. When complete they would be reviewed by a newly appointed PCB Topic (aka Wiki) Pages Editor and folks s/he solicits, and if suitable the authors would be given the opportunity to publish it as a PCB Topic Page which would appear as part of the Education section of the journal. The page would be available from PLoS under a Creative Commons Attribution License. The PCB page would be indexed in PubMed and would provide a service to journal readers. As such it provides author incentive. PCB would only publish the Topic Page when it has been released into the public Wikipedia and the PCB page would become the copy of record. The community would make further enhancements to the Wikipedia page on an on-going basis as per usual.
The upside is that authors would be inclined to provide an initial starting point of high quality material as they get a PLoS publication and are indexed in PubMed. Wikipedia gains good content.
The downside is that if this became popular (more than 2-3 per month) PLoS would need to charge to recover publishing costs, but this would not be the case initially.
Phil Bourne EIC PLoS Computational Biology — Preceding unsigned comment added by Pebourne ( talk • contribs) 14:30, 7 September 2011 (UTC)
Could someone please turn alanine scan into a bluelink? It seems like a pretty important technique and easily understandable (at least in understanding its results, even if not the process of doing it) to the lay public. DMacks ( talk) 14:02, 20 September 2011 (UTC)
Has there been any past discussion of creating a set of pages for the biosynthesis of each amino acid and cofactor? Each amino acid has a small section, but they vary enormously in style. methionine, for example, has one of the more detailed section, but it is really hard to read and describes how E. coli does it (only enterobacteria and yeast trans-sulfurylate, use succinyl and not acetyl and few organisms need/make cobaltamine (B12 for humans)). I would be willing to spend some time on this matter, but I think a universal layout style should be present to make it navigation-friendly. Maybe it could even have a template similar to {{ cladogram}} for a metabolic map. Ecocyc/metacyc has a lot of info and would make work easier, so it is not an overly hard task: the problem would be consistency. -- Squidonius ( talk) 07:04, 21 September 2011 (UTC)
{{
cite web}}
: Cite has empty unknown parameter: |coauthors=
(
help)). However sticking to the old-fashion schematics (see
File:Tryptophan biosynthesis.png for example) still might be the best solution.
Boghog (
talk) 20:47, 21 September 2011 (UTC)
According to the ACS style guide ( ISBN 9780841239999, p. 244), the correct nomenclature is "nucleoside monophosphate", "nucleoside diphosphate", and "nucleoside triphosphate", with the term "nucleotide" referring only to the monophosphate. The template, and articles in, Template:Nucleobases, nucleosides, and nucleotides do not conform to this nomenclature, so I wanted to ask if there are differing guidelines, or whether all the articles really do need to be fixed. Antony–22 ( talk⁄ contribs) 20:07, 3 October 2011 (UTC)
Well, I'm going to go ahead and start making changes. Antony–22 ( talk⁄ contribs) 21:43, 4 October 2011 (UTC)
The citric acid cycle seems like a mature article, and knowledgeable editors seemed to have moved on, leaving a number of unanswered questions, as often happens. See "metabolism" above.
My question (there are others that may be more sophisticated) is that the article seems to say that all Krebs cycles are the same (identical) for all of the Animal Kingdom. That is a shocker. Including ants? Dust mites?
I read that "cats create their own Vitamin C." I know, "citric acid." But the writer was intending the information to be unique to cats and this article definitely makes no distinction except for plants. Is that correct? Thanks. Student7 ( talk) 19:04, 26 October 2011 (UTC)
Hi. I just noticed this new article from a new editor. Could someone please assign an importance and quality rating on the article's talk page? Maybe a welcome and introduction to this WikiProject would be appropriate, but I'll leave that up to you to decide. I've done a fairly thorough online search for copyvio and it appears clean to me. -- Anthonyhcole ( talk) 07:58, 20 November 2011 (UTC)
Immune system is an FA; it was suddenly rewritten, and this needs discussion here. Materialscientist ( talk) 05:12, 8 December 2011 (UTC)
Merge Methylase and Methyltransferase-- 92.203.50.213 ( talk) 14:21, 5 January 2012 (UTC)
On the Talkpage:Pomegranate and the Talkpage:Cranberry a discussion is taking place pertaining to 1) the health effects of the aforementioned fruit and berry, and 2) whether the reviews could belong to the ‘further reading’ – section? I am hoping for a larger community input. Do you have time to take a look? Thank you. Granateple ( talk) 19:19, 7 January 2012 (UTC)
Stated Low Prolactin Levels are associated with the precursor cells to oligodendrocytes that are responsible for creation of Myelin. Lesions in Myelin in time and place is Multiple Sclerosis (MS). There are too many associations with low prolactin levels and MS. Prolactin secretion levels are affected by pineal gland (the third eye sensing levels of light and regulation of circadian cycle. This corresponds to epidemiological data showing high levels of MS in the most northern latitudes, UK, Finland, etc.)at a youthful age in development. If the individual’s youthful development is in the lower latitude levels say South Africa and moves to say UK at the adult age, the individual takes his low risk with him. If the individual moves to the higher latitude locations at the youthful age, he adopts the high risk of MS of the high latitude location. This shows a link with the amount of sunlight availability and the endocrinological control system responsible for creating prolactin.
MS incidence appears to have some relation to post-pregnancy. Again prolactin at play.
My personal observation of dopamine surge activities lacking physical exertion such as gambling and drug use have some association with incidence of MS. It can be explained by the patho-mechanism of excess dopamine levels inhibiting prolactin secretions thereby having the low prolactin levels cause the dying off of the precursor cells to the oligodendrocytes and thereby causing MS.
Another relation between MS and prolactin is ACTH. ACTH secreted by anterior pituitary causes adrenal secretions of cortisol. Personal experience recalls use of ACTH to reverse remissions in MS? Prolactin is also released at the anterior pituitary.
More thought and research to the hormonal, humoral and neural control properties of prolactin may help in better understanding the patho-mechanism of MS.
166.250.44.189 ( talk) 08:04, 11 January 2012 (UTC)
I refer the group to this thread on the Talk page at Major Depressive Disorder concerning the use of Vincent van Gogh's painting "At Eternity's Gate" in that article and to this comment of mine pointing out it has no place in the article and should be removed.
The essence of the complaint is that is fully documented that van Gogh's painting is not at all, nor was ever meant to be, a portrayal of depressive disorder but is rather merely a study of an old man. For that reason alone it should be removed for reasons of encyclopaedic accuracy.
As it stands it necessarily makes a judgement about the nature of depressive disorder, that it necessarily implies despair, even that it necessarily implies suicidal ideation (because of its title and van Gogh's own well known suicide). It is very much to be regretted indeed in my opinion that a Wikipedia administrator, Casliber, a practicising psychiatrist it seems but a poor historian of art, appears to be the prime mover behind perpetuating these poor judgements.
It also mythologises Vincent van Gogh himself who took the greatest care to separate his difficulties in life from his work; the nature of whose illness is not settled but which is not certainly typical of a depressive disorder; who is not documented as suffering from suicidal depressive moods in the last months of his life when this painting was completed and whose suicide itself has in the past year been plausibly questioned by a respected source as rather a manslaughter.
I ask that the image be removed. If it is felt necessary, and I cannot imagine why it should be, that the article be illustrated by a fine art image, then I suggest the original image, Durer's Melancholia, be reinserted. Skirtopodes ( talk) 22:33, 13 January 2012 (UTC)
Last September, there was a discussion ( archive) on whether and how academic journals - namely PLoS Computational Biology - could partner up with Wikipedia to improve coverage of areas within their scope. An update has just been posted here, and your feedback is invited. -- Daniel Mietchen - WiR/OS ( talk) 16:44, 17 January 2012 (UTC)
A request for comment has been made at the above link. Your input is welcome. Boghog ( talk) 20:55, 28 January 2012 (UTC)
Per Talk:Protein homology#discussion1. I'm inclined to agree regarding the need for a distinction, assuming this isn't already covered in another article. It also appears that we don't have an article that talks about structural homology at all really. Although we do seem to have an article on homology modeling, perhaps portions of that could be spun off into a putative structural homology (protein) article? (+)H3N- Protein\Chemist- CO2(-) 16:26, 6 February 2012 (UTC)
I'm running a WikiPedia/Wikimedia Commons workshop at the Biophysical Society in a couple of weeks, with expert help from User:Phoebe and sponsorship by the Education and the Early Careers committees of the society. We anticipate a large audience -- perhaps 50-75 working scientists who want to help edit articles and contribute media, and possibly involve their students also. I have truly enjoyed my own Wiki participation, and spreading this idea is one of things I'd like to accomplish as incoming president of the society.
We are thinking about starting a new WikiProject Biophysics as a subproject under Molecular and Cellular Bioogy to provide a collaborative workspace for them and future biophysicists, but would really appreciate feedback on the best way to proceed. Clearly the physics wikiproject is also suitably relevant; also a task force would be a possible alternative to a WikiProject. Thoughts? Would there be interest in this community in working on a dedicated biophysics project? Would it be sensible to have a subproject here and a task force under Physics (which could perhaps concentrate on topics, or aspects of an article, related to theory and to experimental techniques)? Dcrjsr ( talk) 14:39, 12 February 2012 (UTC)
After various consultations, WikiProject Biophysics has now been started, under Biology -- it has a skeleton main page, and we will be recruiting new participants at next week's Biophysical Society meeting. Any interested Wikipedians would be extremely welcome!! Dcrjsr ( talk) 18:35, 20 February 2012 (UTC)
So, there's a new project which may be of interest to some here. It arises out of Wikipedia:Village_pump_(proposals)#UID_interface_to_Wikipedia, a proposal to make wikipedia articles available by their UID - for instance by their UNIPROT number. Umm. And those two pages are all I have to show you, but I live in hope of input from you to take it all further. -- Tagishsimon (talk) 20:48, 14 February 2012 (UTC)
Hello! As a new page patroller I have just come across the following articles, created by User:Rcrzarg on 10 February. They could use some attention and I am not even sure if they are suitable for inclusion here, so I thought I would give you guys a heads up and see if you had any advice on how to handle them :). They are:
Thanks! -- Cerebellum ( talk) 16:32, 21 February 2012 (UTC)
I am about to embark on improvements to articles relating to circadian clocks, with a particular interest in improving content related to plant circadian clocks. So far I have edited the lede for circadian rhythm, and have moved circadian oscillator to circadain clock. Anyone with any sort of background or interest in chronobiology or circadian clocks in any way, feel free to give me a hand =) the state of affairs at the moment is a bit dire! Gorton k ( talk) 21:41, 1 March 2012 (UTC)
Hi, Molecular and Cellular Biology Wikiproject. Thanks for all the work you do. I have one thing I'd request. I've noticed that many of the articles under the scope of this group have problems with the ordering of the standard "appendix" sections (i.e., "See also", "References", "Further reading", "External links", and so on). Generally those sections go in the order just given. The MOS:APPENDIX page gives further information as well as the rational. I do mostly just MOS:APPENDIX edits and over the years, I have noticed that the chemical, human protein, and genetics articles have the order of the appendices incorrect more than average. Just a moment or two of member's time to read the MOS:APPENDIX page may help to eliminate this issue. Jason Quinn ( talk) 22:17, 9 February 2012 (UTC)
There's a bit of confusion on Commons about the graphs to the right. They say that they show two different genes, and are used in two different articles. However the files themselves are identical. Would 2 different, but related, genes show up identically on this sort of graph? If so - do we need different graphs for each of the genes in question?-- Nilf anion ( talk) 09:08, 3 March 2012 (UTC)
A stub was recently created for Fastidiousness among microbes. I was curious if some of the expertise here could weigh in on moving it to Fastidiousness or Fastidious microbes, or some other title. It seems odd to have a title of an article be an adjective, but I don't have the knowledge of this area to determine the best title. Thoughts? -- TeaDrinker ( talk) 01:46, 26 March 2012 (UTC)
I just posted a major update to Circular permutation in proteins. The page is currently listed a stub. Would someone please evaluate the new article for quality and importance?
I wouldn't normally ask directly, but the update is the first wikipedia article published in collaboration with PLoS as part of their new Topic Page track. As such it will likely receive a significant amount of attention from blogs and the press.
-- Quantum 7 23:14, 29 March 2012 (UTC)
Should this page ( MART-1) merge to MLANA? Please comment at Talk:MART-1. Thanks, D O N D E groovily Talk to me 02:28, 2 April 2012 (UTC)
If anyone is still active here (no more Tim Vickers?), two new articles were created on this today-- I proposed merger to the main article after cleanup. See Talk:Apoptosis#Merger proposal. SandyGeorgia ( Talk) 15:08, 3 April 2012 (UTC)
Hey everyone, I've been heavily editing Folding@home in an effort to get it up to Good Article status. I'm feeling fairly done with the latter half of the article, but I'm having a bit of difficulty in describing the various diseases studied. This is basically the stuff under the "Biomedical research" section. Thing is, I'm learning the molecular processes essentially from scratch, which makes things time consuming since I have to read scientific publications several times before I can understand it enough to cite it. So I'm asking, can someone check my work in that section and let me know if I've incorrectly described the formation of a disease, or if I could say things better? It'll be much easier to tie in F@h's research if I know how the disease develops in the first place, but I'm not a biochem major and I know there are experts here. Any assistance would be appreciated. I'll be watching this page of course. Best, Jesse V. ( talk) 06:56, 7 March 2012 (UTC)
Its now a GA nominee. I'd appreciate it if someone could review it. :D Jesse V. ( talk) 20:43, 5 April 2012 (UTC)
Hi all, I am trying to get the support to set up a WikiProject for immunology. My reasons are stated at the proposal page, a discussion has also be initiated. Currently, I am just trying to get a feel of how many editors are interested, and whether we have enough to build a task group for a one-month drive, or to improve on one major article, to see how feasible it is to have a WikiProject. Any input, whether opposing or supporting, would be very much appreciated. Again, the link to the proposal is here. Many thanks. Kinkreet ~♥moshi moshi♥~ 13:22, 5 April 2012 (UTC)
Wikipedia:HighBeam describes a limited opportunity for Wikipedia editors to have access to
HighBeam Research.
—
Wavelength (
talk) 15:51, 5 April 2012 (UTC)
This is a notice to let you know about Article alerts, a fully-automated subscription-based news delivery system designed to notify WikiProjects and Taskforces when articles are entering Articles for deletion, Requests for comment, Peer review and other workflows ( full list). The reports are updated on a daily basis, and provide brief summaries of what happened, with relevant links to discussion or results when possible. A certain degree of customization is available; WikiProjects and Taskforces can choose which workflows to include, have individual reports generated for each workflow, have deletion discussion transcluded on the reports, and so on. An example of a customized report can be found here.
If you are already subscribed to Article Alerts, it is now easier to
report bugs and
request new features. We are also in the process of implementing a
"news system", which would let projects know about ongoing discussions on a wikipedia-wide level, and other things of interest. The developers also note that some subscribing WikiProjects and Taskforces use the display=none
parameter, but forget to give a link to their alert page. Your alert page should be located at "Wikipedia:PROJECT-OR-TASKFORCE-HOMEPAGE/Article alerts". Questions and feedback should be left at
Wikipedia talk:Article alerts.
Message sent by User:Addbot to all active wiki projects per request, Comments on the message and bot are welcome here.
Thanks. — Headbomb { ταλκ κοντριβς – WP Physics} 09:22, 15 March 2009 (UTC)
I have made a new article on genetics... could i get all to add the article to your watch list! Indigenous Amerindian genetics we need to watch for vandalism..new with no watchers .. Tks guys!!!!! 01:00, 01 March 2011 (UTC)
→ Wikipedia talk:WikiProject Chemistry#List of vegetable fats. 01:00, 01 March 2011 (UTC)
I just wanted to add my two cents. It is great that the articles have theoretical molecular weights, but is it possible to start adding the isoelectric points (pI) on the side bar for protein pages? This is a valuable resource in proteomics especially, and helps define a protein in greater detail. Thanks. — Preceding unsigned comment added by 24.97.96.113 ( talk) 20:20, 5 April 2012 (UTC)
Are SPR (gene) and Sepiapterin reductase the same thing? Please either comment at Talk:Sepiapterin reductase or boldly merge them. Thanks, D O N D E groovily Talk to me 03:46, 29 April 2012 (UTC)
Please comment at Talk:Chimera (EST) as to whether to merge the page into Fusion protein. Thanks, D O N D E groovily Talk to me 01:59, 2 May 2012 (UTC)
Hi all, I am simply an editor who thinks some of the immunology articles on Wikipedia are far from complete and the quality can be easily improved. I'd love to do it all by myself, but it'd be even better to do it in a team, to be more efficient as well as to get a wider viewpoints (from the medical, molecular and cellular viewpoints for example). If you are interested, please go to here and just start editing. The purpose of the page (it's a new page) is simply to get everyone together and collaborate, as to ensure there's editors for different topics. I look forward to working with you soon, any help would be greatly appreciated. Kinkreet ~♥moshi moshi♥~ 01:15, 6 May 2012 (UTC)
Should Glycyl—tRNA synthetase merge with Glycine—tRNA ligase? Please comment at Talk:Glycyl—tRNA synthetase. Also, thanks to everyone at this Wikiproject for promptly commenting on my questions. D O N D E groovily Talk to me 19:21, 7 May 2012 (UTC)
I propose to merge N-linked glycosylation and O-linked glycosylation back with the main Glycosylation page. They were split from that page a few years ago, probably to build them out more. But little has been done to either page, and the O-glycosylation page can be moderately reorganized. When merged together, they create a more complete page that provides content in the correct context. What do you think? Potcherboy ( talk) 17:25, 9 May 2012 (UTC)
Just wanted to let everyone know that I've opened a peer-review on the Folding@home article. It's already achieved GA status, but I'd like to take it further, maybe even meet FA standards if I can. Comments and suggestions would be very much appreciated. Thanks. Jesse V. ( talk) 22:51, 14 May 2012 (UTC)
I'm a newbie on wikipedia and had students edit pages for a graduate class. Trithorax-group proteins has now been improved and it seems it should be included in this WikiProject, along with its sister page, Polycomb-group proteins. Do they need review by someone who reads this page to be added? I'm not clear on how on how this process works and don't feel qualified to assign class and importance ratings. Many thanks. Biolprof ( talk) 01:43, 20 May 2012 (UTC)
Comments on Wikipedia:Village_pump_(idea_lab)#Static_vs_dynamic_topics:_seriously_outdated_articles will be appreciated, so we can get a general perspective on this. Thanks. History2007 ( talk) 13:28, 22 May 2012 (UTC)
see Wikipedia:Templates for discussion/Log/2012 May 31#Template:Protbox. Frietjes ( talk) 20:27, 31 May 2012 (UTC)
Non-helical DNA structure ( Talk:Non-helical DNA structure) is a relatively new article and one which has a lot of content, but is written in an essay style and is mainly written by one editor. I don't feel familiar enough with the subject to properly understand everything in the article, but perhaps someone else from here could review it and make some suggestions? - Zynwyx ( talk) 02:10, 26 May 2012 (UTC)
I have not been able to spend as much time on Wikipedia to keep my watched articles from rotting and I just noticed that Escherichia coli is a patchwork of un-reverted vandalisms and good-faith naive edits that have accumulated since I did some cleaning in January (namely splitting into three articles), but I do not have the time right now to fix it. Does anyone want to adopt a indole-smelling dirty-yellow--coloured friend? -- Squidonius ( talk) 21:36, 5 June 2012 (UTC)
See Template_talk:GNF_Protein_box#Categories. -- Alan Liefting ( talk - contribs) 00:19, 13 June 2012 (UTC)
While I was looking for information to expand and rewrite the Northland Pyrite Mine article I came across the term arcellacean, which I have never herd of before. The term is used in the following sentence: "Oxidation of waste rock dumped along the edge of James Lake resulted in development of acidic lake waste waters adjacent to the pile (< pH 5.0), causing arcellacean taxa to die out with the exception of A. vulgaris." Can someone please make an article for this form of taxa? According to this, arcellaceans are a major group of testaceous rhizopods. However, that is probably not a reliable source because it is a blog. It would also be helpful if someone could me what A. vulgaris stands for. Thanks. Volcano guy 06:51, 18 June 2012 (UTC)
The Eukaryote article says: "All species of large complex organisms are eukaryotes", however the linked article multicellular organism says "Multicellularity exists in both prokaryotes and eukaryotes, and first appeared several billion years ago in cyanobacteria."
If the statement in the second quote is correct, then I think the phrase large complex organism should link to an article of its own and not to multicellular organism. Lifkwe ( talk) 12:58, 24 June 2012 (UTC)
I am in contact with the National Center for Biotechnology Information (who run web services like PubMed Central) over them providing references in a way that allows for easy copy-pasting into Wikipedia articles (similar to what Europeana does or the Biomedical citation maker). Where would be the best place to discuss what Wikipedia template formats (e.g. {{ Cite web}}, {{ Cite journal}}, {{ Citation}}, {{ Cite book}}) would be best to implement at what NCBI projects? Thanks for any pointers. Please reply at WikiProject NIH. -- Daniel Mietchen - WiR/OS ( talk) 03:48, 18 July 2012 (UTC)
Hello all! I’m working with the Saylor foundation to create a series of original, crowd-sourced textbooks that will be openly licensed and freely available on the web and within Saylor’s free, self-paced courses at Saylor.org. We are using Wikibooks as a platform to host this project and hope to garner the interest of existing members of the Wikibooks and Wikipedia community, as well as bring in new members! We thought that some of your members may be interested in contributing to our book Saylor.org's Cell Biology. Azinheira ( talk) 17:40, 18 July 2012 (UTC)
A request for comment has been made at the above link. Your input is welcome. Boghog ( talk) 19:01, 19 July 2012 (UTC)
Hi,
A new article was just added on the cell biologist David L. Spector of Cold Spring Harbor Laboratory. Please feel free to take a look at the article make comments, edits, corrections, or to add content.
Jjjjjjjjjj ( talk) 02:13, 6 August 2012 (UTC)
I couldn't find any trace of this wikiversity project. The link redirects to Wikia, which says "Bad title". I also found this Wikia category page that has been deleted. Shall I delete this link, or has it moved somewhere? Klortho ( talk) 02:07, 17 August 2012 (UTC)
Can someone check this article and mark it as reviewed. After looking through it, I don't see any problems, except I'm unsure of its title. Ryan Vesey 16:08, 17 August 2012 (UTC)
Hi, I am working with Sherry Ogg, a professor at JHU, and with the Wikipedia Education program, to prepare a Wikipedia project for her upcoming online Molecular Biology class (two sections; the course pages are here: one, two). We have in mind providing the students with a list of articles that need work, on topics relevant to the course, and have the students, working in pairs, select among this list, and then work throughout the semester to provide substantive improvements to those articles. We're designing the assignment itself on one of my user pages, if anyone is interested to take a look (and/or make suggestions).
So, first of all, I wanted to make sure that we introduce ourselves, and let you know that we are coming, so hopefully there won't be a huge surprise when a lot of newbies start making major edits to pages in this project's purview. Hopefully if the edits are initially of poor quality, then editors here can help guide the students in ways that don't discourage (I'm sure you all do that anyway!)
Next, we're hoping we can get some suggestions for articles that need work that we could add to our list. We are planning to look at your how you can help section, the Category:Molecular and cellular biology stubs, and your article worklist, but I thought I would first throw this out, in case there are any other suggestions for places to look, or for particular articles that are in dire need of some work. The course uses Watson's Molecular Biology of the Gene, and covers the whole book, so the scope is quite broad. Klortho ( talk) 02:06, 19 August 2012 (UTC)
For months now, I've been working on improving the quality of the Folding@home article. However, I'm having an increasing amount of difficulty finding things to fix or things to add, and I'm running out of what little technical knowledge I have. I hope there are some experts here who can offer an insight on what the article needs next and how to go about taking care of it. Any ideas? • Jesse V. (talk) 05:58, 28 August 2012 (UTC)
Also, can someone please review it and see if it qualifies for A-class? If it's not A-class, please advise on how I can get it up there. • Jesse V. (talk) 14:26, 28 August 2012 (UTC)
Please take a look at our Molecular Biology course page for the upcoming semester, as I described above. If any of you have time and would like to suggest improvements (or just be bold and make them), please do! Klortho ( talk) 12:24, 28 August 2012 (UTC)
Portal:Xray Crystallography, a portal in which you may be interested, has been nominated for deletion. Your opinions on the matter are welcome; please participate in the discussion by adding your comments at Wikipedia:Miscellany for deletion/Portal:Xray Crystallography and please be sure to sign your comments with four tildes (~~~~). You are free to edit the content of Portal:Xray Crystallography during the discussion but should not remove the miscellany for deletion template from the top of the page; such a removal will not end the deletion discussion. Thank you. ··· 日本穣 ? · 投稿 · Talk to Nihonjoe · Join WP Japan! 17:10, 15 September 2012 (UTC)
The article for pulse labelling is in need of some attention. A quick Google search does not bring up any useful definitions of what pulse labelling is, and the Wikipedia article is the first result but not at all helpful. I think it may be the same thing as pulse-chase analysis but I'm not sure, so hopefully someone with relevant knowledge will be willing to improve the page. — Preceding unsigned comment added by Zynwyx ( talk • contribs) 00:07, 18 October 2012 (UTC)
I just wanted to let everyone know that I've nominated Folding@home as a Featured Article candidate. Comments or editing assistance would be most welcome. • Jesse V. (talk) 02:37, 17 September 2012 (UTC)
![]() | This is an archive of past discussions. Do not edit the contents of this page. If you wish to start a new discussion or revive an old one, please do so on the current talk page. |
Archive 1 | Archive 2 | Archive 3 | Archive 4 | Archive 5 | → | Archive 10 |
Could someone please have a look at the requested move of Gene synthesis → Synthetic DNA (see Talk:Gene synthesis#Requested move)? I'm thinking of making additional changes to the article once the location is determined, but can't move it myself. Mikael Häggström ( talk) 04:23, 25 May 2010 (UTC)
Help needed. An anon has deleted 90% of this article, along with most of the references, the marked the rest for deletion. The article has plenty of problems but WAS sourced beyond the initiator's papers. I'm just a page-watcher on this tho I did try to clarify and wikify a little a few months ago. Please see article discussion pageI'll revert the hatchet job but I don't have the time, journal access, or expertise to broaden the article. Dankarl ( talk) 22:22, 27 May 2010 (UTC)
Hi, I'm not sure what the policy on pages for genes and their protein products is, but there seems to be a page each dedicated to PRG4 (the gene) and lubricin (the protein product). Is this OK, or do they need to be merged in some way? Ka Faraq Gatri ( talk) 22:27, 27 May 2010 (UTC)
Hi, I have created some time ago some lists about restriction enzyme cutting sites:
I don't know if it would be useful to add these pages to this WikiProject. What should I do? Just to add the banner? anything else?
The first article ( List of restriction enzyme cutting sites: A) is completed, with the most available higher impact references added, and 8-10 isoschizomers/enzyme added too. I am working in the rest ones, day by day. Flakinho ( talk) 14:28, 28 May 2010 (UTC)
what are the four things connected when a protein is formed in translation? —Preceding unsigned comment added by 97.89.161.119 ( talk) 02:05, 2 June 2010 (UTC)
Crizotinib
The new-ish Wikipedian ScienceRulz2012 ( talk · contribs) has created the article Crizotinib, and asked for my help in developing it.
I think it is within the remit of this project group, so I added the project on the talk page, with an initial assessment of start class/low priority. [4]
I would be very grateful if anyone could look at the article, possibly change the assessment, and make comments on the talk page. Best, Chzz ► 16:28, 10 June 2010 (UTC)
The article on Major urinary proteins is at FAC here. This is probably the most relevant community for the article, so I figured I'd let folks know it's up for review. Emw ( talk) 00:06, 11 June 2010 (UTC)
See eukaryotic gene example. Surely an arbitrary example is not an appropriate topic for an article? Should this be edited and moved to eukaryotic gene or merged somewhere or.. ? mgiganteus1 ( talk) 01:07, 9 June 2010 (UTC)
The FAC nomination for Homologous recombination has been up for about a week and a half, and is in need of further review. As it is a major mechanism of DNA repair and genetic diversification, the subject is one of WikiProject MCB's "High Importance" articles. I'd greatly appreciate any input! Emw ( talk) 00:49, 24 June 2010 (UTC)
Science isn't my area which is why I'm not inclined to do anything about this myself but it seems to me that these two articles are pretty much identical and that one should be turned into a redirect for the other. -- *Kat* ( talk) 14:38, 12 July 2010 (UTC)
I have, again, been doing some major tidying of microscopy related articles, particularly microscope, optical microscope and some smaller edits on digital microscope, USB microscope, stereo microscope, and immunofluorescence. I have been trying to remove strong biases in the articles (most had a bias towards very old and very new technology) and split pages into more logical chunks (for example stereo microscope is now a standalone article). I would greatly appreciate it if anyone could take a quick look at my changes and let me know about any big mistakes or omissions!
I am also trying to create some good example pictures of light microscopy illumination techniques, what do you think of these?
- Zephyris Talk 08:55, 13 July 2010 (UTC)
Hi, everyone. I'm proposing to recategorise all hormones. My idea is to make the subcategories more distinct from each other, and to give more options to someone searching through the categories. Looking for input! - Richard Cavell ( talk) 02:07, 16 July 2010 (UTC)
I recently took some nice DIC microscopy images (or I believe them to be nice anyway) that I took at an internship and I own all the rights to the images...those that I have uploaded have been licenced anyhow. I took a lot of movies which showed vesicles moving about, a cell capturing two gold nanorods and internalizing them, cells thickening and thinning, intercellular connection formation and destruction and also just aesthetically pleasing images? Someone tell me where I could put them or where they might be useful. I particularly like a set of images which showed the fine focal plane precision of DIC (cells visible and in focus in all of the images, but cytoneme and filopodia-like connections disappeared and appeared depending on their focal plane). John Riemann Soong ( talk) 01:43, 19 August 2010 (UTC)
this discussion has been going on for three years. Anyone want to do the deed? Totnesmartin ( talk) 13:33, 23 September 2010 (UTC)
Dear MCBers, I have two quick announcements regarding the Gene Wiki project. First, the NIH has recently funded a grant proposal in my group focused on the Gene Wiki. Some of the work will be on improving the gene pages themselves, and others will be focused on mining the pages for useful data. You can read some more in our blog post. Details are a bit sparse, but only because I haven’t gotten more organized yet. We definitely want to engage as many people as are interested! Feel free to ask any questions here or via email...
Second, Ben Good and I will be presenting on our efforts in a webinar next week (Oct 6, 10AM Pacific) for the NCBO. Anyone is welcome to join in to listen what we’ve been up to. And of course, profuse acknowledgments always go out to the editors who really make the Gene Wiki project successful. Cheers, AndrewGNF ( talk) 00:57, 30 September 2010 (UTC)
Hello,
Could someone take a look at
Polycentric chromosome? It's a new stub. I suspect, from a quick google search, that the original editor may have the wrong end of the stick and the definition could well be incorrect. I'm also not sure whether the subject warrants an entire article or whether it would be best off merged with
Chromosome or maybe
Chromosome abnormality.
Ka Faraq Gatri (
talk) 22:37, 11 October 2010 (UTC)
A disagreement on whether it is appropriate to mention the "God Gene" in the Vesicular monoamine transporter 2 article has developed. I would appreciate input from third parties. Thanks. Boghog ( talk) 04:18, 18 October 2010 (UTC)
There are three outstanding "expert assistance" requests related to MCB on the list:
{{ Expert-subject}} sometimes gets spammed to articles that just need some attention from anybody, but if someone here could please look over these three and figure out what help, if any, was wanted -- and to either fix the articles or to remove the tags, if you can't figure out what's going on -- I'd appreciate it. WhatamIdoing ( talk) 18:01, 18 October 2010 (UTC)
Please contribute to the discussion. Uncle G ( talk) 23:05, 18 October 2010 (UTC)
Could someone with some knowledge of the field check over Pseudo amino acid composition and Low-frequency collective motion in proteins and DNA which were written by two related SPAs, to make sure they are important enough to merit their own articles and whether it is correct to give so much importance to Kuo-Chen Chou's name and work? All of Low-frequency internal ( talk · contribs)'s edits could probably do with being closely scrutinised in fact. Cheers Smartse ( talk) 19:19, 19 October 2010 (UTC)
Several participants in this WikiProject have advanced knowledge of genetics, and I'd like to suggest a way to contribute your knowledge of the professional literature for improving articles all over Wikipedia. Wikipedians reading or editing articles are welcome to look at a bibliography of Anthropology and Human Biology Citations, posted for the use of all Wikipedians who have occasion to edit articles on human genetics and related issues. I happen to have circulating access to a huge academic research library at a university with an active research program in these issues (and to another library that is one of the ten largest public library systems in the United States) and have been researching these issues sporadically since 1989. You can help other Wikipedians by suggesting new sources through comments on that page. It will be extremely helpful for articles on human genetics to edit them according to the Wikipedia standards for reliable sources for medicine-related articles, as it is important to get these issues as well verified as possible. -- WeijiBaikeBianji ( talk) 19:46, 27 October 2010 (UTC)
Please contribute to the discussion. Uncle G ( talk) 01:54, 29 October 2010 (UTC)
Our antibiotic article currently says that they only are only antibacterial, however I just made a stub about a family of antibiotics ( peptaibols) that are antifungal and this usage also appears to apply to other antibiotics like clotrimazole (see this paper). Should the antibiotic article be changed in account of this? (The article is also written from a totally human perspective, something I've bought up elsewhere previously, as it only discusses their use as drugs, rather than by microbes in nature.) Smartse ( talk) 17:37, 29 October 2010 (UTC)
It seems that WP:MCB is not feeling too communicative.
This graph shows the number of edits in the four WP:MCB talk pages, it would be great if it were actually of articles in WP:MCB but that would take more time to do, but I'd assume that the traffic on the WP reflects it's articles (unless everyone is more efficient). Note: The graph has been subjected to
SMA-5.
Basically, WP:MCB's hayday was in 2006 when Help and Announcements were split from Discussion and up to last year it was gathering strength, with a nasty dip between Sept-Dec 08, but now it is drammatically loosing edits.
Two situations:
I am aware there a similar WP-wide effect, but not sure if it is this pronounced. If it is the latter, what can be done? The only thing I can think of is to make it more rewarding for editors and making a MCB barnstar and encorage its use, maybe? (when I give them out I give the bio one but I do not think it is quite the right one) -- Squidonius ( talk) 21:49, 20 September 2010 (UTC)
![]() |
The Molecular Biology Star | |
Not the most valuable award, but some recognition is better than none! |
-- Squidonius ( talk) 20:46, 22 September 2010 (UTC)
To verify the hypothesis that all the edits go on the background, aka the gnome hypothesis :) , I wrote a script to download and analyse all the MCB pages.
The decrease is quite marginal (the data is unmodified, while the black line is a 12-month period moving average (e.i. smoothed out version), whereas the previous graph had relative few edits per month so more noisy so was smoothed), so here is a more succinct pictograph (why a pictograph? It makes the data look more believable in the popular press!), showing there is a 15% drop from last year. I am talking about an absolute difference of 30k edits so any stats will give infinitesimal p-values.
. So there are less edits, but it is not as drammatic as first predicted and it started actually last year... Shame, I quite liked the Gnome hypothesis. The data shows some periodicity, when I have more time I'll do a Furrier analysis to see if it has to do with Northern hemisphere university term times. However, I think there is the Bot hypothesis, in which bots have done most edits, although I have had trouble automatically filtering out bot edits (upto a 3 fold underestimate), which account for over 1/7th of all edits... Parenthetically, edits and editors, as expected, form a power law distribution with a kink caused by bots.
-- Squidonius ( talk) 21:13, 3 October 2010 (UTC)
The decrease is caused mostly by bots: Bot edits have dropped by 65% from last year (October-Dec 2010 corrected) and 75% from 2008, whereas human edits have dropped by 5% per annum since 2010 (gods dropped by 45%), so not so dire after all, but still not good. (apropos, I think I'll bring this analysis somewhere else and stop spamming.) -- Squidonius ( talk) 08:11, 4 October 2010 (UTC)
I spent an hour today playing around with the data and got some interesting results regarding the periodicity of edits across the day (I was surprised as I though that the Euro/US time zones would cancel each out), week (monday procrastination) and year (dip in the summer), any handwaving ideas and hypotheses welcome. As I do not want to spam, I have made a page on my userpage with the graphs [ [5]] and one day I'll get round to finishing it (promise). -- Squidonius ( talk) 23:34, 1 November 2010 (UTC)
I have managed to get a created article and an expansion on the "Did You Know..." list, namely Fluorescent glucose biosensors and Mycoplasma laboratorium, which is always quite fun (and terribly time consuming). I the process I was told by Smartse about the existence of these templates: {{ cite pmid}}, {{ cite doi}} and {{ cite jstor}} which automatically add a full citation and would have saved me uptillions of mouse clicks. So I though I pass the word! A page I have found useful is WP:FOOT, a how-to for references. I have not found a good way of inserting endnote into wikipedia, doi appart). -- Squidonius ( talk) 19:37, 27 October 2010 (UTC)
Hi guys,
It'd be great if you could take a look at Wikipedia:Articles for deletion/Porins and LPS. Ka Faraq Gatri ( talk) 12:36, 6 November 2010 (UTC)
Version 0.8 is a collection of Wikipedia articles selected by the Wikipedia 1.0 team for offline release on USB key, DVD and mobile phone. Articles were selected based on their assessed importance and quality, then article versions (revisionIDs) were chosen for trustworthiness (freedom from vandalism) using an adaptation of the WikiTrust algorithm.
We would like to ask you to review the MCB articles and revisionIDs we have chosen. Selected articles are marked with a diamond symbol (♦) to the right of each article, and this symbol links to the selected version of each article. If you believe we have included or excluded articles inappropriately, please contact us at Wikipedia talk:Version 0.8 with the details. You may wish to look at your WikiProject's articles with cleanup tags and try to improve any that need work; if you do, please give us the new revisionID at Wikipedia talk:Version 0.8. We would like to complete this consultation period by midnight UTC on Sunday, November 14th.
We have greatly streamlined the process since the Version 0.7 release, so we aim to have the collection ready for distribution by the end of November, 2010. As a result, we are planning to distribute the collection much more widely, while continuing to work with groups such as One Laptop per Child and Wikipedia for Schools to extend the reach of Wikipedia worldwide. Please help us, with your WikiProject's feedback!
If you have already provided feedback, we deeply appreciate it. For the Wikipedia 1.0 editorial team, SelectionBot 16:34, 6 November 2010 (UTC)
A new user that I am trying to help get acquainted and familiar with Wikipedia has worked on this article and asked me how it looks, if everything is formatted right (like the infobox he added). Would it be possible for someone to take a look at it? Thanks in advance. AaronY ( talk) 17:23, 12 November 2010 (UTC)
I just found doi: 10.1038/342609a0 and was wondering if we have an article to which gene shears could redirect to? I think it should go to hammerhead ribozyme but just want to check, as that article doesn't mention them and I've never heard of them before. SmartSE ( talk) 11:23, 18 November 2010 (UTC)
(Just a courtesy note.) There has been some discussion recently about whether Wikipedia:Scientific citation guidelines needs to be updated to reflect current practice. This wikiproject is one of the projects that had signed on to this guideline in the past. If you have any comments or concerns about the guideline, please feel free to comment at Wikipedia talk:Scientific citation guidelines. If this project no longer wants to be named on the guideline page, you may remove yourself from the list at the top of the guideline page. — Carl ( CBM · talk) 18:56, 22 November 2010 (UTC)
The article about the bacterium with the genome which was synthesised by the JCVI institute is in Mycoplasma laboratorium, which is a different organism but work of the same group. Should be split? if so, what name should it have? Mycoplasma genitalium JCVI-1.0? Is the name Mycoplasma laboratorium the best choice for the page name? (see discussion) -- Squidonius ( talk) 21:55, 1 December 2010 (UTC)
There are a number of articles concerning gene/proteins where there is no human ortholog. Some of these articles transclude the {{ infobox protein}} template. This is less than ideal since many of the external links are to human databases (e.g., HGNCid and OMIM) whereas others are "hard wired" to human data (e.g., RefSeq and Chromosome). In order to overcome this limitation, I created a new {{ infobox nonhuman protein}} template in which the RefSeq and Chromosome link now should work with any species. In addition, two additional parameters, organism and TaxID have been added so that the species may be specified. An example of the template in use may be found in a recently created uterine serpin article. Comments and suggestion for improving the {{ infobox nonhuman protein}} template are welcome.
I also wanted to acknowledge new MCB WikiProject member User:Ufpete for the great job he did in creating the uterine serpin article! Boghog ( talk) 07:41, 2 December 2010 (UTC)
Hi. This article was tagged as a suspected copyvio; I don't find any evidence to support that, but it looks like a potential content fork of Meiosis. It had been tagged for merger, but no conversation opened on the subject. I went ahead and redirected the article, but I'm hoping to get some review from somebody who can determine if there is valid content to be merged or if it can/should be turned into a stand-alone article. I'd be grateful if somebody with the background for that would take a shot at it. :) -- Moonriddengirl (talk) 22:55, 21 November 2010 (UTC)
A request for comment has been made at the above link. Your input is welcome. Boghog ( talk) 23:15, 6 December 2010 (UTC)
One focuses on the biology/enzymology, other on the chemistry, of apparently the same actual enzyme-class. Seems ripe for merge/redirect, but which should be the actual article? Is there an MCB naming guideline for enzymes, or anyone have a feel for the "more common" name for this one? DMacks ( talk) 14:08, 12 December 2010 (UTC)
I stumbled upon it while doing cleanup, and it strikes me as something very odd to write. Headbomb { talk / contribs / physics / books} 04:01, 31 December 2010 (UTC)
The protein C article is currently undergoing a good article review (see Talk:Protein_C/GA1). Your input is welcome. Boghog ( talk) 22:01, 3 January 2011 (UTC)
Fellow WP:MCBers. I've recently been speaking with a (responsible) New York based journalist who is working on a story on the people and motivations behind the biological content on Wikipedia. She is attending the upcoming American Association for the Advancement of Science meeting and was wondering whether any Wikipedians were going. If you are, she would like to meet with you. Leave me a message or email me and I can put you in touch with her. Her request is as follows:
Rockpocke t 10:18, 14 January 2011 (UTC)
I've removed the diagram on the right from six articles, as its accuracy has been contested. Help from knowledgeable contributors would be appreciated. Please keep discussion consolidated at Talk:Cytotoxic T cell#Misleading Diagram. Adrian J. Hunter( talk• contribs) 13:12, 22 January 2011 (UTC)
I've worked a little bit on Mechanism section. I would be grateful if anybody could go through the text and check style, comprehensiveness, grammar... I would like to push it to FA or GA status but biggest problem are missing citations. If you know any article which can be cited there, please do so. Thanks. Mashin6 ( talk) 00:30, 28 January 2011 (UTC)
Hello MCB members! I came across the article " Lipid raft" and found that it did not meet GA criteria. I have asked for a reassessment. However, because there is no "GA review page", I suspect that user:WIstutts (who labeled the article "GA class") may have classified it without knowing of the GA review process. This user appears to be no longer active.
I would appreciate any input on this matter. I am not sure what to do in this situation. -- Tea with toast (talk) 22:06, 3 February 2011 (UTC)
There's an RfC at Template talk:Taxobox colour#In light of the luminosity increase. Please share your thoughts there. Bob the WikipediaN ( talk • contribs) 15:53, 7 February 2011 (UTC)
Can someone here who actually knows the field (unlike myself) take a look at Small nucleolar RNA SNORA64/SNORA10 family? I found this entry while working on Great Backlog Drive. Looking as an outsider, it seems odd to me that this one entry, out of all of the small nucleolar RNA articles, has a really unusual name. Is there a good reason for SNORA64 and SNORA10 to be grouped together into the same article? I understand that they are homologous, but it seems like they should still have separate entries. The external links don't help (the Rfam page is mostly just a copy of this WP article, and the snoRNAbase entries both say "Nothing was found." Before I do the cleanup that the page needs, I'd like to confirm whether or not this should actually be a single article, and if this is the correct. Thanks for your expert help! Qwyrxian ( talk) 05:50, 5 February 2011 (UTC)
ACA10 GGTCTCTCAGCTCCGCTTAACCACACGGGTCCAGTGTGTGCTTGGCGTGTTTTCAGGGAG ACA64 -----GTTGGTTGAAAATCGCCCC-CGGCTTTGGCCGTGGCCGCGGGTGAGATTCGGCGC * * * * ** * *** * * ** * *** * ** ........(((((.((((.(((.((((.(((((((....))))))).))))....))))) ACA10 GCAGAGAAA--GGCTCTCCTAATGCACGACAGACCCGCCCAGAATGGCCTCTCTGTTCCT ACA64 CCAGAGCCCCCGGGGGCCTCAGCTCACCGCGCGCTGCCCCATG--TGCGGCGGTGAAACC ***** ** * * *** * * **** ** * ** * )).)))))....(((((((((..(((((((.(((............))))))))))...) ACA10 AGGAGTGCGACAATT ACA64 CAGGCCCCGACAGGC * ***** )))))))).......
Hi everyone, I think epitope mapping should be divided into T cell epitope mapping and B cell epitope mapping. ---- Annie D. — Preceding unsigned comment added by AnnieDWiki ( talk • contribs) 14:16, 13 February 2011 (UTC)
I have a difficulty with the way this entire section has been handled. The people who use Wikipedia aren't just scientists. Housewives and high school students and writers use this as a reference source too. They have no idea what you're talking about when you start right out with the high end information. I'm a computer engineer and writer. I have no training in biology whatsoever. ...even managed to miss high school biology. I came here to get information about triticale. I'm well read and know quite a bit about the subject already. I'm also pretty intelligent. With all that I couldn't manage to get any information out of that page. All the sentences were for those people "in the know". A reference page that can only be used by those people who already know the information is no use to anyone. At least lighten up on the first paragraph. Give us lay people a break! — Preceding unsigned comment added by Sack36 ( talk • contribs) 11:13, 30 January 2011 (UTC)
Sigh. I consider this quirk rather extensive but I will give you a list of the articles I looked at most recently:
By the way, I'd like to commend you all for the Quinoa article. Very clear and informative with very little geek speak. deepsack ( talk) 13:08, 31 January 2011 (UTC)
Thanks, Ehamberg. It looks great. I've added it to the article. WhatamIdoing ( talk) 18:05, 15 February 2011 (UTC)
Someone familiar with cloning might want to take a look at these articles. There is a merge proposal and some cleanup in tone and referencing is needed. Regards, P. D. Cook Talk to me! 19:58, 24 February 2011 (UTC)
Hi—another question from the editor entirely ignorant of molbio info. The reason I'm editing these articles is because I'm trying to work on the backlog of pages with Stylistic problems, which a number of snoRNA pages are marked with (usually with {{jargon}}</jargon>). While looking for models to follow, I saw that all of the SNORA articles use at the bottom the navigational template <nowiki>{{Small nucleolar RNA SNORA}}. This template contains not only SNORA snoRNA, but also a variety of others (J, MB, etc.). However, articles other than SNORA articles don't have this template. It seems to me that an article like Small nucleolar RNA J33, which is listed on and linked in {{Small nucleolar RNA SNORA}} should also have that template. Alternatively, it seems like we could remove the non-snoRNA articles from that template. Does that make sense? It's odd to me to see a navigational template that has links to articles that do not themselves use that template. Is there some specific reason for this? Do you believe the template should be added to all of the articles it links to (and, if so, possibly renamed?), or should the other articles be removed from the template.
Thanks again for bearing with a clear non-expert. Qwyrxian ( talk) 05:09, 18 February 2011 (UTC)
These articles
Have empty references - the PMID id is there in the ref name (where I've looked)but the content is null - an HTML comment and some markup.
Secondly reading one of the references I found we didn't have an article on amino acid response - so I made a little stub. For reasons I won't go into I think this is a very important area of cell biology - unfortunately my ignorance in this area is somewhat staggering. It would be fantastic if we had a decent article (or set of articles) that lad out the current state of knowledge of the pathways for each deficiency, and from ATF4 onwards.
Good to have them fixed.
Rich
Farmbrough, 00:32, 4 March 2011 (UTC).
I have recently been looking at the referral stats for a number of biological databases to find out how much traffic Wikipedia is generating for them. I contacted the nice people at the RCSB PDB and they tell me that 9% of referrals (not including direct traffic from bookmarks etc) come from Wikipedia. This is a cool statistic! Andreas at PDB tells me that on average visitors to PDB from Wikipedia stay for less time than others. But one final statistic that Andreas would like suggestions about is why, "in contrast to all other site trends we have fewer wikipedia referrals this year compared to last year. Perhaps something got changed in the presentation of links back to us, or wikipedia usage is dropping?". Does anyone have any insight into this? Thanks Alexbateman ( talk) 13:23, 28 February 2011 (UTC)
{{
cite journal}}
: Explicit use of et al. in: |author=
(
help); Unknown parameter |month=
ignored (
help)CS1 maint: multiple names: authors list (
link)
Everyone agree that PDB is a great resource. Yes, it was significantly improved. Please add links to PDB anywere, and everyone will be very happy. But no one should replace good links to other sites by links to PDB. This is per WP:NPOV policy, broadly speaking. Of course one might argue that PDBsum is redundant and therefore should be replaced. However, this is not the case: PDBsum has a graphical view of protein sequence with secondary structure, a graphical interface to Procheck, different and better in certain aspects interfaces to ligands, substrates and subunits, and other features which are not present in main PDB portal or which are made very differently. What would you tell about a scientist who replaces references to publications of his competitors by references to his own publications? Doing so would be also against NPOV policy. Hodja Nasreddin ( talk) 14:27, 5 March 2011 (UTC)
Molecular and Cellular Biology WikiProject members, please, this is being discussed at:
Wikipedia:Articles for deletion/Names of small numbers http://en.wikipedia.org/wiki/Wikipedia:Articles_for_deletion/Names_of_small_numbers#Names_of_small_numbers
Thank you. Pandelver ( talk) 00:17, 12 March 2011 (UTC)
In wikipedia if bacteria cause a disease they are well documented, otherwise they are a red link. Escherichia coli has an extensive review of its pathogenic strains and a malformed Biotech section. I added a section on diversity and created a new page called ( Escherichia coli (molecular biology), where I have written about the history of K-12 and B strains but have not mentioned molecular cloning, unfortunately I will not have any editing time in the near future, so if anyone wants to add a section please do! -- Squidonius ( talk) 13:47, 12 March 2011 (UTC)
Over at BRCA2, a mutation "999del5" is identified as truncating the protein. What does the "5" mean here? I know what "999delA" would mean, but I don't think I've seen a number used, and I can't find the answer. WhatamIdoing ( talk) 20:32, 17 March 2011 (UTC)
Why are em dashes used on List of EC numbers (EC 2) and many of the templates at the bottom of that page? Sources may use en dashes, but no-one uses an em dash within a word. These shouldn't even be redirects. I thought about moving the em-dash redirects to en dashes, but there are so many of them that I was worried I might gunk things up. Am I missing something? Also, aren't many of these ambiguous with the use of only hyphens? — kwami ( talk) 22:50, 18 March 2011 (UTC)
{{
cite journal}}
: Unknown parameter |month=
ignored (
help)), there are 5268 Enzyme Commission entries (record = "ID"). In this particular file, en/em dashes in the accepted name (record = "DE") are represented by a double hyphen "--". There are 226 entries with a double hyphen (see
User:Boghog/Sandbox5 for wiki links, two links per line, left link is based on the enzyme name where the double hyphen has been replaced with a single hyphen, "--" → "-", right link double hyphen has been replaced with an em dash, "--" → "—"). It appears that the articles names have em dashes replaced with hyphens whereas the proper enzyme names containing the em dashes are redirects. In my opinion, the direction of these redirects should be reversed.
Boghog (
talk) 10:38, 20 March 2011 (UTC)Database | Link | Symbol |
---|---|---|
EC number | [9] | — (em dash) |
IntEnz | [10] | — (em dash) |
BRENDA | [11] | - (hyphen) |
ExPASy | [12] | -- (double hyphen) |
KEGG | [13] | --- (triple hyphen) |
What would be the 2nd source using en dashes?
Double hyphens are the usual substitute for em dashes, and single hyphens the substitute for en dashes. (Triple hyphens are occasionally for em dashes used when double hyphens are used for en dashes.) So we have no evidence that anyone uses en dashes, while 3 and possibly 4 use em dashes. That's convincing. I'll start moving. — kwami ( talk) 21:47, 20 March 2011 (UTC)
I fixed a dozen or so links on your sandbox (parentheses and clipped names). — kwami ( talk) 22:03, 20 March 2011 (UTC)
Is there somewhere here discussing why (or if) the self replicating molecule only got created once? 82.137.72.133 ( talk) 10:51, 31 March 2011 (UTC) Yes, so I went and posted it on the link for queries at the top of the page and it came back here Ppeetteerr ( talk) 12:31, 4 April 2011 (UTC)
Hi,
Plindenbaum and I were editing some pages on Orthology databases. We discussed making a subcategory of Biological databases called something like Orthology databases. Of course one could subclassify the biological database articles more completely. Perhaps using the NAR database collection classification:
http://www.oxfordjournals.org/nar/database/c/
Has this been discussed before? Alexbateman ( talk) 08:22, 4 April 2011 (UTC)
Is there somewhere here about why (or if) the self replicating molecule only got created once? Ppeetteerr ( talk) 12:30, 4 April 2011 (UTC)
Is this self replication my answer? (joke) Ppeetteerr ( talk) 12:35, 4 April 2011 (UTC)
A number of editors, both named and anonymous, have been adding external links to GeneReviews. Usually this is from accounts that have never edited before and subsequently make no contributions. Instead of using the {{ Infobox disease}}, the editors use the external links section. Often, the links are only to very peripherally related conditions. Today it was 205.152.158.201 ( talk · contribs) who did a link adding spree.
Does anyone know why this is happening, and does everyone agree that these links are not always useful? What could we do to streamline these edits? Does anyone know the presumed person who is behind this? JFW | T@lk 17:04, 5 April 2011 (UTC)
I have no intention of chasing away the editor and would love to pin them down and turn them into content generators. JFW | T@lk 21:44, 5 April 2011 (UTC)
A new editor has asked for help at WP:FEEDBACK with Satellite cell (glial). It sounds like she's a student and has significantly expanded the article. If someone who knows a thing or two about this would please leave a note on the article's talk page at Talk:Satellite cell (glial), then I'm sure she would be grateful. WhatamIdoing ( talk) 19:26, 8 April 2011 (UTC)
Monopolin has been an orphan since the winter of 2009. "Mono" means "lonely" in Greek... Will spring 2011 bring hope? You can make a difference. walk victor falk talk 11:14, 10 April 2011 (UTC)
Hi all! I currently have peer reviews running for two articles I have worked on, DNA nanotechnology ( review page) and Nucleic acid design ( review page). I'd appreciate it if you could take a look and leave any feedback you could give. Thanks! Antony–22 ( talk⁄ contribs) 01:42, 19 April 2011 (UTC)
Just a quick pointer that there is an interesting thread over at WikiProject Chemicals about enabling Jmol on wikipedia. This is something that might be interesting for many pages here, too. [14] -- Andreas ( talk) 04:08, 8 April 2011 (UTC)
Hi everyone,
My biological clocks class is working on a few circadian biology articles. We've submitted cryptochrome ( create review page) and Candolle ( create review page) at GAN, but so far no reviewers have shown up; if one of you could help with a review, that would be great. We're also tackling the following articles:
We haven't set up formal peer reviews for the latter articles, so the talk pages for the articles are fine for feedback. General feedback for the class can go here or on my talk page. Thanks! C1ock122 ( talk) 21:17, 19 April 2011 (UTC)
Bleb is a (the) member of the non-existent category
Category:Cell motility. I'm not sure it belongs there, however I am also inclined to think that would be a useful category. I leave it to the experts.
Rich
Farmbrough, 23:48, 24 April 2011 (UTC).
I wanted to know the consensus for what headers and sections a protein or gene article should have and what are the preferred orders, but both wp:Manual of style (protein articles) and wp:Manual of style (gene articles) are currently red at this time of posting. They should be made blue, either by redirect or by article creation. Mikael Häggström ( talk) 06:10, 15 May 2011 (UTC)
A major issue that needs a note in any
wp:Manual of style (protein article) is in handling Interactions-sections, such as that found in
Rb#Interactions or
BRCA1#Interactions.
A previous suggestion on splitting them to separate articles was apparently not feasible. I think, however, that the problem rather is the current presentation of them as tediously long lists of proteins. After all, it's not the protein interaction itself that is notable, but rather any effect of it, such as stimulation or inhibition of protein activity - and such effects should be given in the Wikipedia article rather than simply referring to external sources like a
collection of external links (which Wikipedia should not be). Therefore, I suggest adding the guideline that a protein interaction is notable for inclusion only when there's a comment on any effects of the interaction, such as specific stimulation or inhibition of protein activity, and may otherwise be deleted. The comprehensive lists can still be found in external (and more updated) databases for this purpose, such as
CPDB.
Mikael Häggström (
talk) 06:55, 15 May 2011 (UTC)
Hi, just came across this.. are these two articles about the same thing? Sorry I didn't know where else to ask, I'm not knowledgeable on this subject. -- œ ™ 16:59, 15 May 2011 (UTC)
I'd hold off on a merger. These may need dab hat notes. Zooid (zoöid) /ˈzoʊ.ɔɪd/ and zoid (zoïd) /ˈzoʊ.ɪd/ are old synonyms, dating from the mid 19th century at the latest; it's quite possible that they have been formally distributed among the two meanings they were used for.
The broad historical usage is attested in the OED, which says of zooid:
It may well be that that early use has now been made specific to zoid.
BTW, there's also zoon /ˈzoʊ.ɒn/, pl. zoa, which is,
— kwami ( talk) 00:17, 16 May 2011 (UTC)
The article Moonlighting protein was created recently as part of a school project. I started applying wiki love but just discovered the Gene sharing article which covers the same topic. Which name is better? Anyone want to help merge these? Discussion at Talk:Moonlighting protein. Quarl ( talk) 06:14, 17 April 2011 (UTC)
Someone has just pointed out a nice resource called FactorBook to me: http://zhome.umassmed.edu/elgg/ I suggested to the authors that they add links to their resource from the relevant Wikipedia articles. I already did one example for them at the IRF4 article. Does that sound reasonable? Alexbateman ( talk) 07:24, 24 May 2011 (UTC)
There is a merge proposal at Talk:Α+β proteins that could do with some attention. Hans Adler 21:39, 25 May 2011 (UTC)
Hello all,
My circadian rhythms class has finished improving our selected circadian biology Wikipedia articles. We would appreciate if someone from the WikiProject could reassess the articles we've worked on (list here). C1ock122 ( talk) 19:36, 26 May 2011 (UTC)
I would appreciate some advice on the talk page of Acetyl-Coenzyme A acetyltransferase regarding some merges. Thanks. Cmcnicoll ( talk) 23:01, 31 May 2011 (UTC)
We are currently trying to breath new life into WikiProject Computational Biology. There is been quite a bit of overlap with this project and if there are any editors who are interested we could do with some help and advice in these early days. An important step currently is simply to identify Computational Biology articles and get them assessed so we can work out what needs working on. If you can spare a little time I'm sure we can give this project momentum enough to roll on its own. Thanks Alexbateman ( talk) 08:27, 9 June 2011 (UTC)
Hi, there's currently a requested move underway at Talk:SPINK5#Requested move which has been listed for a week and is yet to get any comments. I think the lack of comments is at least partially due to the technical aspect of the request (eg is it a protein or is it a gene? Hard for the lay person like myself to know). So, just wondering if any of this project's members who have any knowledge on the subject could add their thoughts to the requested move. Cheers, Jenks24 ( talk) 16:06, 22 June 2011 (UTC)
In Space, solar winds, mostly charged particles such as protons, penetrate living tissue and damage DNA, apparently some simple forms of life can survive on the outside of the International Space Station. But I don't know much about this, and you can read the ISS article and still be confused about the topic, I could sure use some help with it. I put some stuff in about tetrigrades? I can't even spell them, small invertebrate anyhow. Anyone got a spare 5 minutes ? Penyulap talk 15:12, 28 June 2011 (UTC)
I have nominated International Space Station for a featured article review here. Please join the discussion on whether this article meets featured article criteria. Articles are typically reviewed for two weeks. If substantial concerns are not addressed during the review period, the article will be moved to the Featured Article Removal Candidates list for a further period, where editors may declare "Keep" or "Delist" the article's featured status. The instructions for the review process are here.
{{ Chemformula}} has been nominated for deletion. 65.94.47.63 ( talk) 04:56, 30 June 2011 (UTC)
I thought I might notify that I have gone ahead and split E.coli, which now comprises:
Any help is appreciated in fixing all issues resulting from copy-edits. Thanks -- Squidonius ( talk) 07:20, 17 July 2011 (UTC)
Dear All,
I would like to add links to the FactorBook database which stores information about transcription factors particularly with respect to the ENCODE project. I have added a test link to IRF4, but have a list of a further 120 links that could be added. Here is the FactorBook pages for CTCF:
http://www.factorbook.org/mediawiki/index.php/CTCF
Do others feel it is appropriate to add these linkd to Wikipedia? Alexbateman ( talk) 10:15, 1 August 2011 (UTC)
Hello! We currently have two articles, Bacteriostat and Bacteriostatic agent, both apparently about the same subject, and neither of which have any supporting cites. I'd greatly appreciate it if someone knowledgeable could take a look at these, for fact-checking and possible merging. -- The Anome ( talk) 16:35, 3 August 2011 (UTC)
Dear MCB Project. It looks as though the PyMOL article still reflects a pre-Schrödinger version of said software. Does anyone here have the necessary familiarity with the Schrödinger version of PyMOL to update this article? It seems like there should be a way to do this while still preserving references to its open source development and the impact Warren DeLano had on the field. I(q) = User(q)· Talk(q) 01:40, 30 August 2011 (UTC)
Recently I've had some discussions with the editors at the journal Gene about how to encourage academics to improve Wikipedia articles on human genes. I started a discussion at the Village Pump. Please chime in there if you have any thoughts. Cheers, AndrewGNF ( talk) 22:34, 9 September 2011 (UTC)
The article Capping enzyme complex has been proposed for deletion. The proposed-deletion notice added to the article should explain why.
While all contributions to Wikipedia are appreciated, content or articles may be deleted for any of several reasons.
You may prevent the proposed deletion by removing the {{proposed deletion/dated}}
notice, but please explain why in your
edit summary or on
the article's talk page.
Please consider improving the article to address the issues raised. Removing {{proposed deletion/dated}}
will stop the
proposed deletion process, but other
deletion processes exist. In particular, the
speedy deletion process can result in deletion without discussion, and
articles for deletion allows discussion to reach
consensus for deletion.
Sławomir Biały (
talk) 20:20, 10 September 2011 (UTC)
We would like to solicit your feedback on a proposal from PLoS Computational Biology (PCB). The journal proposes to help establish new Wikipedia pages in the field of computational biology that are not currently covered, either at all, or exist only as a stub. The pages would be created in the Wikipedia sandbox. When complete they would be reviewed by a newly appointed PCB Topic (aka Wiki) Pages Editor and folks s/he solicits, and if suitable the authors would be given the opportunity to publish it as a PCB Topic Page which would appear as part of the Education section of the journal. The page would be available from PLoS under a Creative Commons Attribution License. The PCB page would be indexed in PubMed and would provide a service to journal readers. As such it provides author incentive. PCB would only publish the Topic Page when it has been released into the public Wikipedia and the PCB page would become the copy of record. The community would make further enhancements to the Wikipedia page on an on-going basis as per usual.
The upside is that authors would be inclined to provide an initial starting point of high quality material as they get a PLoS publication and are indexed in PubMed. Wikipedia gains good content.
The downside is that if this became popular (more than 2-3 per month) PLoS would need to charge to recover publishing costs, but this would not be the case initially.
Phil Bourne EIC PLoS Computational Biology — Preceding unsigned comment added by Pebourne ( talk • contribs) 14:30, 7 September 2011 (UTC)
Could someone please turn alanine scan into a bluelink? It seems like a pretty important technique and easily understandable (at least in understanding its results, even if not the process of doing it) to the lay public. DMacks ( talk) 14:02, 20 September 2011 (UTC)
Has there been any past discussion of creating a set of pages for the biosynthesis of each amino acid and cofactor? Each amino acid has a small section, but they vary enormously in style. methionine, for example, has one of the more detailed section, but it is really hard to read and describes how E. coli does it (only enterobacteria and yeast trans-sulfurylate, use succinyl and not acetyl and few organisms need/make cobaltamine (B12 for humans)). I would be willing to spend some time on this matter, but I think a universal layout style should be present to make it navigation-friendly. Maybe it could even have a template similar to {{ cladogram}} for a metabolic map. Ecocyc/metacyc has a lot of info and would make work easier, so it is not an overly hard task: the problem would be consistency. -- Squidonius ( talk) 07:04, 21 September 2011 (UTC)
{{
cite web}}
: Cite has empty unknown parameter: |coauthors=
(
help)). However sticking to the old-fashion schematics (see
File:Tryptophan biosynthesis.png for example) still might be the best solution.
Boghog (
talk) 20:47, 21 September 2011 (UTC)
According to the ACS style guide ( ISBN 9780841239999, p. 244), the correct nomenclature is "nucleoside monophosphate", "nucleoside diphosphate", and "nucleoside triphosphate", with the term "nucleotide" referring only to the monophosphate. The template, and articles in, Template:Nucleobases, nucleosides, and nucleotides do not conform to this nomenclature, so I wanted to ask if there are differing guidelines, or whether all the articles really do need to be fixed. Antony–22 ( talk⁄ contribs) 20:07, 3 October 2011 (UTC)
Well, I'm going to go ahead and start making changes. Antony–22 ( talk⁄ contribs) 21:43, 4 October 2011 (UTC)
The citric acid cycle seems like a mature article, and knowledgeable editors seemed to have moved on, leaving a number of unanswered questions, as often happens. See "metabolism" above.
My question (there are others that may be more sophisticated) is that the article seems to say that all Krebs cycles are the same (identical) for all of the Animal Kingdom. That is a shocker. Including ants? Dust mites?
I read that "cats create their own Vitamin C." I know, "citric acid." But the writer was intending the information to be unique to cats and this article definitely makes no distinction except for plants. Is that correct? Thanks. Student7 ( talk) 19:04, 26 October 2011 (UTC)
Hi. I just noticed this new article from a new editor. Could someone please assign an importance and quality rating on the article's talk page? Maybe a welcome and introduction to this WikiProject would be appropriate, but I'll leave that up to you to decide. I've done a fairly thorough online search for copyvio and it appears clean to me. -- Anthonyhcole ( talk) 07:58, 20 November 2011 (UTC)
Immune system is an FA; it was suddenly rewritten, and this needs discussion here. Materialscientist ( talk) 05:12, 8 December 2011 (UTC)
Merge Methylase and Methyltransferase-- 92.203.50.213 ( talk) 14:21, 5 January 2012 (UTC)
On the Talkpage:Pomegranate and the Talkpage:Cranberry a discussion is taking place pertaining to 1) the health effects of the aforementioned fruit and berry, and 2) whether the reviews could belong to the ‘further reading’ – section? I am hoping for a larger community input. Do you have time to take a look? Thank you. Granateple ( talk) 19:19, 7 January 2012 (UTC)
Stated Low Prolactin Levels are associated with the precursor cells to oligodendrocytes that are responsible for creation of Myelin. Lesions in Myelin in time and place is Multiple Sclerosis (MS). There are too many associations with low prolactin levels and MS. Prolactin secretion levels are affected by pineal gland (the third eye sensing levels of light and regulation of circadian cycle. This corresponds to epidemiological data showing high levels of MS in the most northern latitudes, UK, Finland, etc.)at a youthful age in development. If the individual’s youthful development is in the lower latitude levels say South Africa and moves to say UK at the adult age, the individual takes his low risk with him. If the individual moves to the higher latitude locations at the youthful age, he adopts the high risk of MS of the high latitude location. This shows a link with the amount of sunlight availability and the endocrinological control system responsible for creating prolactin.
MS incidence appears to have some relation to post-pregnancy. Again prolactin at play.
My personal observation of dopamine surge activities lacking physical exertion such as gambling and drug use have some association with incidence of MS. It can be explained by the patho-mechanism of excess dopamine levels inhibiting prolactin secretions thereby having the low prolactin levels cause the dying off of the precursor cells to the oligodendrocytes and thereby causing MS.
Another relation between MS and prolactin is ACTH. ACTH secreted by anterior pituitary causes adrenal secretions of cortisol. Personal experience recalls use of ACTH to reverse remissions in MS? Prolactin is also released at the anterior pituitary.
More thought and research to the hormonal, humoral and neural control properties of prolactin may help in better understanding the patho-mechanism of MS.
166.250.44.189 ( talk) 08:04, 11 January 2012 (UTC)
I refer the group to this thread on the Talk page at Major Depressive Disorder concerning the use of Vincent van Gogh's painting "At Eternity's Gate" in that article and to this comment of mine pointing out it has no place in the article and should be removed.
The essence of the complaint is that is fully documented that van Gogh's painting is not at all, nor was ever meant to be, a portrayal of depressive disorder but is rather merely a study of an old man. For that reason alone it should be removed for reasons of encyclopaedic accuracy.
As it stands it necessarily makes a judgement about the nature of depressive disorder, that it necessarily implies despair, even that it necessarily implies suicidal ideation (because of its title and van Gogh's own well known suicide). It is very much to be regretted indeed in my opinion that a Wikipedia administrator, Casliber, a practicising psychiatrist it seems but a poor historian of art, appears to be the prime mover behind perpetuating these poor judgements.
It also mythologises Vincent van Gogh himself who took the greatest care to separate his difficulties in life from his work; the nature of whose illness is not settled but which is not certainly typical of a depressive disorder; who is not documented as suffering from suicidal depressive moods in the last months of his life when this painting was completed and whose suicide itself has in the past year been plausibly questioned by a respected source as rather a manslaughter.
I ask that the image be removed. If it is felt necessary, and I cannot imagine why it should be, that the article be illustrated by a fine art image, then I suggest the original image, Durer's Melancholia, be reinserted. Skirtopodes ( talk) 22:33, 13 January 2012 (UTC)
Last September, there was a discussion ( archive) on whether and how academic journals - namely PLoS Computational Biology - could partner up with Wikipedia to improve coverage of areas within their scope. An update has just been posted here, and your feedback is invited. -- Daniel Mietchen - WiR/OS ( talk) 16:44, 17 January 2012 (UTC)
A request for comment has been made at the above link. Your input is welcome. Boghog ( talk) 20:55, 28 January 2012 (UTC)
Per Talk:Protein homology#discussion1. I'm inclined to agree regarding the need for a distinction, assuming this isn't already covered in another article. It also appears that we don't have an article that talks about structural homology at all really. Although we do seem to have an article on homology modeling, perhaps portions of that could be spun off into a putative structural homology (protein) article? (+)H3N- Protein\Chemist- CO2(-) 16:26, 6 February 2012 (UTC)
I'm running a WikiPedia/Wikimedia Commons workshop at the Biophysical Society in a couple of weeks, with expert help from User:Phoebe and sponsorship by the Education and the Early Careers committees of the society. We anticipate a large audience -- perhaps 50-75 working scientists who want to help edit articles and contribute media, and possibly involve their students also. I have truly enjoyed my own Wiki participation, and spreading this idea is one of things I'd like to accomplish as incoming president of the society.
We are thinking about starting a new WikiProject Biophysics as a subproject under Molecular and Cellular Bioogy to provide a collaborative workspace for them and future biophysicists, but would really appreciate feedback on the best way to proceed. Clearly the physics wikiproject is also suitably relevant; also a task force would be a possible alternative to a WikiProject. Thoughts? Would there be interest in this community in working on a dedicated biophysics project? Would it be sensible to have a subproject here and a task force under Physics (which could perhaps concentrate on topics, or aspects of an article, related to theory and to experimental techniques)? Dcrjsr ( talk) 14:39, 12 February 2012 (UTC)
After various consultations, WikiProject Biophysics has now been started, under Biology -- it has a skeleton main page, and we will be recruiting new participants at next week's Biophysical Society meeting. Any interested Wikipedians would be extremely welcome!! Dcrjsr ( talk) 18:35, 20 February 2012 (UTC)
So, there's a new project which may be of interest to some here. It arises out of Wikipedia:Village_pump_(proposals)#UID_interface_to_Wikipedia, a proposal to make wikipedia articles available by their UID - for instance by their UNIPROT number. Umm. And those two pages are all I have to show you, but I live in hope of input from you to take it all further. -- Tagishsimon (talk) 20:48, 14 February 2012 (UTC)
Hello! As a new page patroller I have just come across the following articles, created by User:Rcrzarg on 10 February. They could use some attention and I am not even sure if they are suitable for inclusion here, so I thought I would give you guys a heads up and see if you had any advice on how to handle them :). They are:
Thanks! -- Cerebellum ( talk) 16:32, 21 February 2012 (UTC)
I am about to embark on improvements to articles relating to circadian clocks, with a particular interest in improving content related to plant circadian clocks. So far I have edited the lede for circadian rhythm, and have moved circadian oscillator to circadain clock. Anyone with any sort of background or interest in chronobiology or circadian clocks in any way, feel free to give me a hand =) the state of affairs at the moment is a bit dire! Gorton k ( talk) 21:41, 1 March 2012 (UTC)
Hi, Molecular and Cellular Biology Wikiproject. Thanks for all the work you do. I have one thing I'd request. I've noticed that many of the articles under the scope of this group have problems with the ordering of the standard "appendix" sections (i.e., "See also", "References", "Further reading", "External links", and so on). Generally those sections go in the order just given. The MOS:APPENDIX page gives further information as well as the rational. I do mostly just MOS:APPENDIX edits and over the years, I have noticed that the chemical, human protein, and genetics articles have the order of the appendices incorrect more than average. Just a moment or two of member's time to read the MOS:APPENDIX page may help to eliminate this issue. Jason Quinn ( talk) 22:17, 9 February 2012 (UTC)
There's a bit of confusion on Commons about the graphs to the right. They say that they show two different genes, and are used in two different articles. However the files themselves are identical. Would 2 different, but related, genes show up identically on this sort of graph? If so - do we need different graphs for each of the genes in question?-- Nilf anion ( talk) 09:08, 3 March 2012 (UTC)
A stub was recently created for Fastidiousness among microbes. I was curious if some of the expertise here could weigh in on moving it to Fastidiousness or Fastidious microbes, or some other title. It seems odd to have a title of an article be an adjective, but I don't have the knowledge of this area to determine the best title. Thoughts? -- TeaDrinker ( talk) 01:46, 26 March 2012 (UTC)
I just posted a major update to Circular permutation in proteins. The page is currently listed a stub. Would someone please evaluate the new article for quality and importance?
I wouldn't normally ask directly, but the update is the first wikipedia article published in collaboration with PLoS as part of their new Topic Page track. As such it will likely receive a significant amount of attention from blogs and the press.
-- Quantum 7 23:14, 29 March 2012 (UTC)
Should this page ( MART-1) merge to MLANA? Please comment at Talk:MART-1. Thanks, D O N D E groovily Talk to me 02:28, 2 April 2012 (UTC)
If anyone is still active here (no more Tim Vickers?), two new articles were created on this today-- I proposed merger to the main article after cleanup. See Talk:Apoptosis#Merger proposal. SandyGeorgia ( Talk) 15:08, 3 April 2012 (UTC)
Hey everyone, I've been heavily editing Folding@home in an effort to get it up to Good Article status. I'm feeling fairly done with the latter half of the article, but I'm having a bit of difficulty in describing the various diseases studied. This is basically the stuff under the "Biomedical research" section. Thing is, I'm learning the molecular processes essentially from scratch, which makes things time consuming since I have to read scientific publications several times before I can understand it enough to cite it. So I'm asking, can someone check my work in that section and let me know if I've incorrectly described the formation of a disease, or if I could say things better? It'll be much easier to tie in F@h's research if I know how the disease develops in the first place, but I'm not a biochem major and I know there are experts here. Any assistance would be appreciated. I'll be watching this page of course. Best, Jesse V. ( talk) 06:56, 7 March 2012 (UTC)
Its now a GA nominee. I'd appreciate it if someone could review it. :D Jesse V. ( talk) 20:43, 5 April 2012 (UTC)
Hi all, I am trying to get the support to set up a WikiProject for immunology. My reasons are stated at the proposal page, a discussion has also be initiated. Currently, I am just trying to get a feel of how many editors are interested, and whether we have enough to build a task group for a one-month drive, or to improve on one major article, to see how feasible it is to have a WikiProject. Any input, whether opposing or supporting, would be very much appreciated. Again, the link to the proposal is here. Many thanks. Kinkreet ~♥moshi moshi♥~ 13:22, 5 April 2012 (UTC)
Wikipedia:HighBeam describes a limited opportunity for Wikipedia editors to have access to
HighBeam Research.
—
Wavelength (
talk) 15:51, 5 April 2012 (UTC)
This is a notice to let you know about Article alerts, a fully-automated subscription-based news delivery system designed to notify WikiProjects and Taskforces when articles are entering Articles for deletion, Requests for comment, Peer review and other workflows ( full list). The reports are updated on a daily basis, and provide brief summaries of what happened, with relevant links to discussion or results when possible. A certain degree of customization is available; WikiProjects and Taskforces can choose which workflows to include, have individual reports generated for each workflow, have deletion discussion transcluded on the reports, and so on. An example of a customized report can be found here.
If you are already subscribed to Article Alerts, it is now easier to
report bugs and
request new features. We are also in the process of implementing a
"news system", which would let projects know about ongoing discussions on a wikipedia-wide level, and other things of interest. The developers also note that some subscribing WikiProjects and Taskforces use the display=none
parameter, but forget to give a link to their alert page. Your alert page should be located at "Wikipedia:PROJECT-OR-TASKFORCE-HOMEPAGE/Article alerts". Questions and feedback should be left at
Wikipedia talk:Article alerts.
Message sent by User:Addbot to all active wiki projects per request, Comments on the message and bot are welcome here.
Thanks. — Headbomb { ταλκ κοντριβς – WP Physics} 09:22, 15 March 2009 (UTC)
I have made a new article on genetics... could i get all to add the article to your watch list! Indigenous Amerindian genetics we need to watch for vandalism..new with no watchers .. Tks guys!!!!! 01:00, 01 March 2011 (UTC)
→ Wikipedia talk:WikiProject Chemistry#List of vegetable fats. 01:00, 01 March 2011 (UTC)
I just wanted to add my two cents. It is great that the articles have theoretical molecular weights, but is it possible to start adding the isoelectric points (pI) on the side bar for protein pages? This is a valuable resource in proteomics especially, and helps define a protein in greater detail. Thanks. — Preceding unsigned comment added by 24.97.96.113 ( talk) 20:20, 5 April 2012 (UTC)
Are SPR (gene) and Sepiapterin reductase the same thing? Please either comment at Talk:Sepiapterin reductase or boldly merge them. Thanks, D O N D E groovily Talk to me 03:46, 29 April 2012 (UTC)
Please comment at Talk:Chimera (EST) as to whether to merge the page into Fusion protein. Thanks, D O N D E groovily Talk to me 01:59, 2 May 2012 (UTC)
Hi all, I am simply an editor who thinks some of the immunology articles on Wikipedia are far from complete and the quality can be easily improved. I'd love to do it all by myself, but it'd be even better to do it in a team, to be more efficient as well as to get a wider viewpoints (from the medical, molecular and cellular viewpoints for example). If you are interested, please go to here and just start editing. The purpose of the page (it's a new page) is simply to get everyone together and collaborate, as to ensure there's editors for different topics. I look forward to working with you soon, any help would be greatly appreciated. Kinkreet ~♥moshi moshi♥~ 01:15, 6 May 2012 (UTC)
Should Glycyl—tRNA synthetase merge with Glycine—tRNA ligase? Please comment at Talk:Glycyl—tRNA synthetase. Also, thanks to everyone at this Wikiproject for promptly commenting on my questions. D O N D E groovily Talk to me 19:21, 7 May 2012 (UTC)
I propose to merge N-linked glycosylation and O-linked glycosylation back with the main Glycosylation page. They were split from that page a few years ago, probably to build them out more. But little has been done to either page, and the O-glycosylation page can be moderately reorganized. When merged together, they create a more complete page that provides content in the correct context. What do you think? Potcherboy ( talk) 17:25, 9 May 2012 (UTC)
Just wanted to let everyone know that I've opened a peer-review on the Folding@home article. It's already achieved GA status, but I'd like to take it further, maybe even meet FA standards if I can. Comments and suggestions would be very much appreciated. Thanks. Jesse V. ( talk) 22:51, 14 May 2012 (UTC)
I'm a newbie on wikipedia and had students edit pages for a graduate class. Trithorax-group proteins has now been improved and it seems it should be included in this WikiProject, along with its sister page, Polycomb-group proteins. Do they need review by someone who reads this page to be added? I'm not clear on how on how this process works and don't feel qualified to assign class and importance ratings. Many thanks. Biolprof ( talk) 01:43, 20 May 2012 (UTC)
Comments on Wikipedia:Village_pump_(idea_lab)#Static_vs_dynamic_topics:_seriously_outdated_articles will be appreciated, so we can get a general perspective on this. Thanks. History2007 ( talk) 13:28, 22 May 2012 (UTC)
see Wikipedia:Templates for discussion/Log/2012 May 31#Template:Protbox. Frietjes ( talk) 20:27, 31 May 2012 (UTC)
Non-helical DNA structure ( Talk:Non-helical DNA structure) is a relatively new article and one which has a lot of content, but is written in an essay style and is mainly written by one editor. I don't feel familiar enough with the subject to properly understand everything in the article, but perhaps someone else from here could review it and make some suggestions? - Zynwyx ( talk) 02:10, 26 May 2012 (UTC)
I have not been able to spend as much time on Wikipedia to keep my watched articles from rotting and I just noticed that Escherichia coli is a patchwork of un-reverted vandalisms and good-faith naive edits that have accumulated since I did some cleaning in January (namely splitting into three articles), but I do not have the time right now to fix it. Does anyone want to adopt a indole-smelling dirty-yellow--coloured friend? -- Squidonius ( talk) 21:36, 5 June 2012 (UTC)
See Template_talk:GNF_Protein_box#Categories. -- Alan Liefting ( talk - contribs) 00:19, 13 June 2012 (UTC)
While I was looking for information to expand and rewrite the Northland Pyrite Mine article I came across the term arcellacean, which I have never herd of before. The term is used in the following sentence: "Oxidation of waste rock dumped along the edge of James Lake resulted in development of acidic lake waste waters adjacent to the pile (< pH 5.0), causing arcellacean taxa to die out with the exception of A. vulgaris." Can someone please make an article for this form of taxa? According to this, arcellaceans are a major group of testaceous rhizopods. However, that is probably not a reliable source because it is a blog. It would also be helpful if someone could me what A. vulgaris stands for. Thanks. Volcano guy 06:51, 18 June 2012 (UTC)
The Eukaryote article says: "All species of large complex organisms are eukaryotes", however the linked article multicellular organism says "Multicellularity exists in both prokaryotes and eukaryotes, and first appeared several billion years ago in cyanobacteria."
If the statement in the second quote is correct, then I think the phrase large complex organism should link to an article of its own and not to multicellular organism. Lifkwe ( talk) 12:58, 24 June 2012 (UTC)
I am in contact with the National Center for Biotechnology Information (who run web services like PubMed Central) over them providing references in a way that allows for easy copy-pasting into Wikipedia articles (similar to what Europeana does or the Biomedical citation maker). Where would be the best place to discuss what Wikipedia template formats (e.g. {{ Cite web}}, {{ Cite journal}}, {{ Citation}}, {{ Cite book}}) would be best to implement at what NCBI projects? Thanks for any pointers. Please reply at WikiProject NIH. -- Daniel Mietchen - WiR/OS ( talk) 03:48, 18 July 2012 (UTC)
Hello all! I’m working with the Saylor foundation to create a series of original, crowd-sourced textbooks that will be openly licensed and freely available on the web and within Saylor’s free, self-paced courses at Saylor.org. We are using Wikibooks as a platform to host this project and hope to garner the interest of existing members of the Wikibooks and Wikipedia community, as well as bring in new members! We thought that some of your members may be interested in contributing to our book Saylor.org's Cell Biology. Azinheira ( talk) 17:40, 18 July 2012 (UTC)
A request for comment has been made at the above link. Your input is welcome. Boghog ( talk) 19:01, 19 July 2012 (UTC)
Hi,
A new article was just added on the cell biologist David L. Spector of Cold Spring Harbor Laboratory. Please feel free to take a look at the article make comments, edits, corrections, or to add content.
Jjjjjjjjjj ( talk) 02:13, 6 August 2012 (UTC)
I couldn't find any trace of this wikiversity project. The link redirects to Wikia, which says "Bad title". I also found this Wikia category page that has been deleted. Shall I delete this link, or has it moved somewhere? Klortho ( talk) 02:07, 17 August 2012 (UTC)
Can someone check this article and mark it as reviewed. After looking through it, I don't see any problems, except I'm unsure of its title. Ryan Vesey 16:08, 17 August 2012 (UTC)
Hi, I am working with Sherry Ogg, a professor at JHU, and with the Wikipedia Education program, to prepare a Wikipedia project for her upcoming online Molecular Biology class (two sections; the course pages are here: one, two). We have in mind providing the students with a list of articles that need work, on topics relevant to the course, and have the students, working in pairs, select among this list, and then work throughout the semester to provide substantive improvements to those articles. We're designing the assignment itself on one of my user pages, if anyone is interested to take a look (and/or make suggestions).
So, first of all, I wanted to make sure that we introduce ourselves, and let you know that we are coming, so hopefully there won't be a huge surprise when a lot of newbies start making major edits to pages in this project's purview. Hopefully if the edits are initially of poor quality, then editors here can help guide the students in ways that don't discourage (I'm sure you all do that anyway!)
Next, we're hoping we can get some suggestions for articles that need work that we could add to our list. We are planning to look at your how you can help section, the Category:Molecular and cellular biology stubs, and your article worklist, but I thought I would first throw this out, in case there are any other suggestions for places to look, or for particular articles that are in dire need of some work. The course uses Watson's Molecular Biology of the Gene, and covers the whole book, so the scope is quite broad. Klortho ( talk) 02:06, 19 August 2012 (UTC)
For months now, I've been working on improving the quality of the Folding@home article. However, I'm having an increasing amount of difficulty finding things to fix or things to add, and I'm running out of what little technical knowledge I have. I hope there are some experts here who can offer an insight on what the article needs next and how to go about taking care of it. Any ideas? • Jesse V. (talk) 05:58, 28 August 2012 (UTC)
Also, can someone please review it and see if it qualifies for A-class? If it's not A-class, please advise on how I can get it up there. • Jesse V. (talk) 14:26, 28 August 2012 (UTC)
Please take a look at our Molecular Biology course page for the upcoming semester, as I described above. If any of you have time and would like to suggest improvements (or just be bold and make them), please do! Klortho ( talk) 12:24, 28 August 2012 (UTC)
Portal:Xray Crystallography, a portal in which you may be interested, has been nominated for deletion. Your opinions on the matter are welcome; please participate in the discussion by adding your comments at Wikipedia:Miscellany for deletion/Portal:Xray Crystallography and please be sure to sign your comments with four tildes (~~~~). You are free to edit the content of Portal:Xray Crystallography during the discussion but should not remove the miscellany for deletion template from the top of the page; such a removal will not end the deletion discussion. Thank you. ··· 日本穣 ? · 投稿 · Talk to Nihonjoe · Join WP Japan! 17:10, 15 September 2012 (UTC)
The article for pulse labelling is in need of some attention. A quick Google search does not bring up any useful definitions of what pulse labelling is, and the Wikipedia article is the first result but not at all helpful. I think it may be the same thing as pulse-chase analysis but I'm not sure, so hopefully someone with relevant knowledge will be willing to improve the page. — Preceding unsigned comment added by Zynwyx ( talk • contribs) 00:07, 18 October 2012 (UTC)
I just wanted to let everyone know that I've nominated Folding@home as a Featured Article candidate. Comments or editing assistance would be most welcome. • Jesse V. (talk) 02:37, 17 September 2012 (UTC)