From Wikipedia, the free encyclopedia
T1+ case notes from 2019-11-20 dump
Belukurichi -
wikt:katthi - pichuva katthi (a hunter's dagger)
3 -
BNC (software) -
wikt:ezbounces ,
wikt:cubnc (probably OK:
wikt:dircproxy ): all software product jargon.
Ira Leviton (
talk ) 22:09, 10 December 2019 (UTC)
reply
1 -
BX Plastics -
wikt:lactoid : a product that was made by this company. I'm not sure if it should be capitalized, can't find any info on it.
Ira Leviton (
talk ) 22:09, 10 December 2019 (UTC)
reply
1 -
Bag -
wikt:bʰak : showing pronunciation.
Ira Leviton (
talk ) 22:57, 10 December 2019 (UTC)
reply
1 -
Bagnoles-de-l'Orne -
wikt:curists : people who believe in the curative power of spas.
Ira Leviton (
talk ) 22:57, 10 December 2019 (UTC)
reply
1 -
Balearic dialect -
wikt:you : showing proper grammar.
Ira Leviton (
talk ) 18:12, 7 December 2019 (UTC)
reply
1 -
Baluan-Pam language -
wikt:you : showing grammar.
Ira Leviton (
talk ) 18:12, 7 December 2019 (UTC)
reply
2 -
Bambera -
wikt:you ,
wikt:your : translation of poetry.
Ira Leviton (
talk ) 18:12, 7 December 2019 (UTC)
reply
58 -
Bang! (card game) -
wikt:Fargo(only ,
wikt:turn(but ,
wikt:it's ,
wikt:doesn't ,
wikt:you ,
wikt:you ,
wikt:you ,
wikt:you ,
wikt:your ,
wikt:you ,
wikt:you ,
wikt:you ,
wikt:your ,
wikt:your ,
wikt:your ,
wikt:your ,
wikt:you ,
wikt:you ,
wikt:your ,
wikt:your ,
wikt:you ,
wikt:you ,
wikt:you ,
wikt:your ,
wikt:you ,
wikt:you ,
wikt:you ,
wikt:you ,
wikt:your ,
wikt:you ,
wikt:you ,
wikt:you ,
wikt:charactes ,
wikt:your ,
wikt:you ,
wikt:your ,
wikt:you ,
wikt:your ,
wikt:your ,
wikt:your ,
wikt:you ,
wikt:your ,
wikt:you ,
wikt:your ,
wikt:your ,
wikt:your ,
wikt:your ,
wikt:you ,
wikt:you ,
wikt:you ,
wikt:your ,
wikt:you ,
wikt:your ,
wikt:you ,
wikt:your ,
wikt:your ,
wikt:you ,
wikt:your : this article needs a rewrite, and I indicated that with a tag.
Ira Leviton (
talk ) 18:12, 7 December 2019 (UTC)
reply
1 -
Bardhaman -
wikt:deuls : a type of temple in India (plural).
Ira Leviton (
talk ) 18:12, 7 December 2019 (UTC)
reply
2 -
Barranquenho -
wikt:cruh ,
wikt:olivareh : both written this way to show pronunciation.
Ira Leviton (
talk ) 18:12, 7 December 2019 (UTC)
reply
1 -
Barred parakeet -
wikt:creamino : a local name for the white type of this parakeet.
Ira Leviton (
talk ) 18:12, 7 December 2019 (UTC)
reply
1 -
Basilica of San Domenico -
wikt:protogothic ; seems OK.
Ira Leviton (
talk ) 04:19, 3 December 2019 (UTC)
reply
1 -
Bassinthedust -
wikt:elebrity : written deliberately as $elebrity.
Ira Leviton (
talk ) 04:19, 3 December 2019 (UTC)
reply
1 -
Basudev Than -
wikt:tʱan : attempting to show pronunciation.
Ira Leviton (
talk ) 04:19, 3 December 2019 (UTC)
reply
1 -
Bates distribution -
wikt:sgn(nx : part of a mathematical formula.
Ira Leviton (
talk ) 04:19, 3 December 2019 (UTC)
reply
1 -
Battlement -
wikt:carnels : apparently an arcane alternative for crenels.
Ira Leviton (
talk ) 16:32, 5 December 2019 (UTC)
reply
1 -
Be.A -
wikt:rtist : part of a band name.
Ira Leviton (
talk ) 02:22, 6 December 2019 (UTC)
reply
1 -
Behavior mutation -
wikt:shibire : a genetics term or name.
Ira Leviton (
talk ) 19:50, 7 December 2019 (UTC)
reply
1 -
Bella Donna (comics) -
wikt:it's : I'm not sure why this was flagged, it looks like it's the tail end of "Gambit's", after a character in this comic.
Ira Leviton (
talk ) 00:12, 8 December 2019 (UTC)
reply
5 -
Bellerophontida -
wikt:cyrtiform : an arcane term in the study of mollusks.
Ira Leviton (
talk ) 00:12, 8 December 2019 (UTC)
reply
1 -
Belvedere Tiburon Library -
wikt:jumpies : a type of ride at carnivals, maybe a regional word.
Ira Leviton (
talk ) 00:12, 8 December 2019 (UTC)
reply
1 -
Bemalambdidae -
wikt:connated : an arcane biology term.
Ira Leviton (
talk ) 00:12, 8 December 2019 (UTC)
reply
2 -
Benwick -
wikt:ravag : written deliberately as "ravag'd".
Ira Leviton (
talk ) 02:15, 9 December 2019 (UTC)
reply
2 -
Benjamin Boothby -
wikt:rederick ,
wikt:oseph : written deliberately as F(rederick) and J(oseph).
Ira Leviton (
talk ) 02:15, 9 December 2019 (UTC)
reply
1 -
Berwick Area School District -
wikt:of .75 : part of a mathematical formula.
Ira Leviton (
talk ) 22:27, 9 December 2019 (UTC)
reply
1 -
Beşparmak Mountains -
wikt:bivergent : probably not a real word, used on this page to describe something that diverges in two ways.
Ira Leviton (
talk ) 02:23, 13 December 2019 (UTC)
reply
1 -
Bhagwan Lal Indraji - (probably OK:
wikt:nanghat ) - changed to nanaghat
Strickesel (
talk )
1 -
Bhairavi (thaat) -
wikt:thaats - not a typo
Strickesel (
talk )
2 -
Bhakri -
wikt:nachni ,
wikt:bhakhris - not typos
Strickesel (
talk )
1 -
Bheemdatta -
wikt:bhashi - the name of a place
Strickesel (
talk )
1 -
Bhikari Bal -
wikt:pauthi - part of the name of a song
Strickesel (
talk )
1 -
Bhimdatta Panta -
wikt:you - in the translation of a phrase
Strickesel (
talk )
1 -
Bhira Kheri -
wikt:smrati - possibly the name of a college
Strickesel (
talk )
1 -
Bhitauli -
wikt:mazaars - seems to be a word for tomb
Strickesel (
talk )
3 -
Big Brother (British TV series) -
wikt:how's : this appears as "show's". I'm not sure why it was detected.
Ira Leviton (
talk ) 19:55, 11 December 2019 (UTC)
reply
4 -
Big Brother Brasil 14 -
wikt:how's : ditto.
Ira Leviton (
talk ) 22:44, 11 December 2019 (UTC)
reply
3 -
Big-headed pantanal swamp turtle -
wikt:pect ,
wikt:plastra : the first is unclear but intentional (needs explanation in the article), the second is the plural of plastron, part of a turtle shell.
5 -
Bikini variants -
wikt:hikini : a variant style of bikini.
Ira Leviton (
talk ) 19:55, 11 December 2019 (UTC)
reply
8 -
Bilingual pun -
wikt:don't ,
wikt:you're ,
wikt:eltin ,
wikt:you ,
wikt:your ,
wikt:you ,
wikt:you ,
wikt:you : these are all translations or to show pronunciation.
Ira Leviton (
talk ) 22:44, 11 December 2019 (UTC)
reply
5 -
Bintulu -
wikt:precondensate : chemistry jargon.
Ira Leviton (
talk ) 22:44, 11 December 2019 (UTC)
reply
1 -
Bison hunting -
wikt:Big .50s : a type of gun (plural).
Ira Leviton (
talk ) 22:44, 11 December 2019 (UTC)
reply
3 -
Blue-headed racket-tail -
wikt:kinawihan : a local name for the subject of the page.
Ira Leviton (
talk ) 03:43, 10 December 2019 (UTC)
reply
1 -
Blumentopf -
wikt:raportage : not a real word, but used by the artist of the page.
Ira Leviton (
talk ) 03:43, 10 December 2019 (UTC)
reply
1 -
Boletus auripes - (probably OK:
wikt:pseudocystidia ): an anatomic part of the fungus.
Ira Leviton (
talk ) 19:31, 11 December 2019 (UTC)
reply
3 -
Bolixo -
wikt:tlmp : software jargon.
Ira Leviton (
talk ) 19:31, 11 December 2019 (UTC)
reply
8 -
Bombyx mori -
wikt:chawkie ,
wikt:chawkie ,
wikt:chawkie ,
wikt:chawkie : a larval form of this Bombyx.
Ira Leviton (
talk ) 19:31, 11 December 2019 (UTC)
reply
2 -
Brasiliense Futebol Clube -
wikt:candangos (+ sing.) - add to Wikt
5 -
Brasília -
wikt:superquadras (+ sing.) - add to Wikt
1 -
Breakfast (Philippine TV program) -
wikt:reakfast : written deliberately as B(reakfast).
Ira Leviton (
talk ) 02:54, 10 December 2019 (UTC)
reply
3 -
Breusch–Godfrey test -
wikt:lmtest ,
wikt:bgodfrey , (probably OK:
wikt:bgtest ): all software jargon.
Ira Leviton (
talk ) 02:54, 10 December 2019 (UTC)
reply
1 -
Buncrana -
wikt:metadolerite - add to Wikt
TS+DOT+ case notes from 2019-11-20 dump
2 -
B. Russell Murphy -
wikt:finished .500 ,
wikt:a .500 : winning percentages, used correctly.
Ira Leviton (
talk ) 03:19, 13 December 2019 (UTC)
reply
9 -
B. V. S. Ravi -
wikt:Varma,Puri ,
wikt:Jagannath,Krishna ,
wikt:Vamsi,Rana ,
wikt:Daggubati,Allu ,
wikt:Arjun,Ravi ,
wikt:Teja,Dil ,
wikt:Raju,Mohan ,
wikt:Babu,Manchu ,
wikt:Ready .He
1 -
BC Lions -
wikt:played .500 : winning percentage, used correctly.
Ira Leviton (
talk ) 19:59, 13 December 2019 (UTC)
reply
2 -
BD−22 5866 -
wikt:most .04 ,
wikt:most .26 : precise decimal measures. Does 0 have to precede these?
Ira Leviton (
talk ) 19:59, 13 December 2019 (UTC)
reply
4 -
Bacterial oxidation -
wikt:iron(III ,
wikt:iron(III ,
wikt:iron(III ,
wikt:iron(III : chemistry terminology.
Ira Leviton (
talk ) 21:22, 13 December 2019 (UTC)
reply
1 -
Bad Griesbach (Rottal) -
wikt:i.Rottal : German-style abbreviation, without a space.
Ira Leviton (
talk ) 21:52, 13 December 2019 (UTC)
reply
1 -
Bahraini dinar -
wikt:abbreviated .د : seems to have inadvertently missed an Arabic letter.
Ira Leviton (
talk ) 22:05, 28 December 2019 (UTC)
reply
1 -
Balika Vadhu -
wikt:nuotaka : a word from a language on the Indian subcontinent but I can't tell which.
Ira Leviton (
talk ) 03:12, 29 December 2019 (UTC) \\ prbably Hindi (nuotaka is part of a show title, that show is in Hindi)
Xurizuri (
talk ) 14:25, 30 December 2020 (UTC)
reply
19 -
Balinese textiles -
wikt:otonin ,
wikt:bebali ,
wikt:bebali ,
wikt:cenana ,
wikt:membah ,
wikt:bebali ,
wikt:bebali (probably OK:
wikt:polèng ,
wikt:cepuk ,
wikt:predana ,
wikt:cepuk ,
wikt:gerinsing ,
wikt:geringseng ,
wikt:tumpal ,
wikt:ancur ,
wikt:songkèt ,
wikt:songkèt ,
wikt:metatah ): these are in italics, but I can't tell which language with certainty.
Ira Leviton (
talk ) 03:12, 29 December 2019 (UTC) \\ the languages of Balinese people are Balinese, Sasak, and Indonesian. We'd need to get speakers to rule out/in what language they are.
Xurizuri (
talk ) 14:25, 30 December 2020 (UTC)
reply
1 -
Baltimore Bandits -
wikt:playing .500 : winning percentage.
Ira Leviton (
talk ) 15:38, 29 December 2019 (UTC)
reply
2 -
Bangalore Fort -
wikt:hoblis ,
wikt:varahas : a language from the Indian subcontinent, but I can't tell which.
Ira Leviton (
talk ) 15:38, 29 December 2019 (UTC) \\ It's probably Kannada (but there's definitely room for uncertainty). they may also be terms that are copied over to English when referring to those items
Xurizuri (
talk ) 14:25, 30 December 2020 (UTC)
reply
2 -
Bangarh -
wikt:XI,II ,
wikt:Uma(Usha : written as Uma(Usha?)vana to show uncertanty of a name.
Ira Leviton (
talk ) 15:38, 29 December 2019 (UTC)
reply
1 -
Barbara Stevens (basketball) -
wikt:the .500 : winning percentage.
Ira Leviton (
talk ) 20:34, 29 December 2019 (UTC)
reply
1 -
Barcelona Dragons -
wikt:a .500 : winning percentage.
Ira Leviton (
talk ) 20:34, 29 December 2019 (UTC)
reply
6 -
Battle of Al Hudaydah -
wikt:there's ,
wikt:here's ,
wikt:won't ,
wikt:didn't ,
wikt:doesn't ,
wikt:territories.The : this is a fully protected page; I made a request for administrators to make the edits.
Ira Leviton (
talk ) 02:05, 27 December 2019 (UTC)
reply
8 -
Batwoman - (probably OK:
wikt:retconed ). Retcon is a noun, but probably not a verb. I requested a clarification.
Ira Leviton (
talk ) 20:43, 26 December 2019 (UTC)
reply
1 -
Bearded seal -
wikt:oogrook : this is an Inuit word, but Intuit languages don't have ISO 693 codes so I don't know how to give it the proper language tag.
Ira Leviton (
talk ) 19:01, 26 December 2019 (UTC)
reply
4 -
Beckmann rearrangement -
wikt:haloimines ,
wikt:haloimines ,
wikt:nitrillium : chemical names.
Ira Leviton (
talk ) 19:01, 26 December 2019 (UTC)
reply
2 -
Bedlam Theatre -
wikt:how's : part of "show's" was detected.
Ira Leviton (
talk ) 02:33, 26 December 2019 (UTC)
reply
8 -
Belousov–Zhabotinsky reaction -
wikt:ruthenium(II ,
wikt:cerium(IV ,
wikt:cerium(IV ,
wikt:cerium(III ,
wikt:cerium(IV ,
wikt:cerium(III ,
wikt:cerium(IV : chemistry terminology.
Bet-Boa
1 -
Beth Gibbons -
wikt:in .O : ".O rang" is the name of a band.
Ira Leviton (
talk ) 16:44, 25 December 2019 (UTC)
reply
2 -
Beth Lapides -
wikt:unhomophobic ,
wikt:unhacky : terms used by the subject of the age.
Ira Leviton (
talk ) 16:44, 25 December 2019 (UTC)
reply
1 -
Beth Nolan -
wikt:K7 .E645 : I marked it with a clarify tag, it's jargon.
Ira Leviton (
talk ) 16:44, 25 December 2019 (UTC)
reply
1 -
Bethany LeSueur -
wikt:a .910 : winning percentage.
Ira Leviton (
talk )
2 -
Bettiah Raj -
wikt:mallikana ,
wikt:quanungoi : unclear language, from the Indian subcontinent.
Ira Leviton (
talk ) 16:44, 25 December 2019 (UTC)
reply
4 -
Bigg Boss (Hindi season 3) -
wikt:performances(ref ,
wikt:it's : seems to be part of "Rohit's" which is OK.
Ira Leviton (
talk ) 22:46, 15 December 2019 (UTC)
reply
1 -
Bill Berrier -
wikt:of .675 : winning percentage.
Ira Leviton (
talk ) 20:22, 14 December 2019 (UTC)
reply
1 -
Bill Berry (basketball) -
wikt:over .500 : winning percentage.
Ira Leviton (
talk ) 20:22, 14 December 2019 (UTC)
reply
1 -
Bill Carmody -
wikt:a .500 : winning percentage.
Ira Leviton (
talk ) 20:22, 14 December 2019 (UTC)
reply
1 -
Bill Decker -
wikt:of .696 : winning percentage.
Ira Leviton (
talk ) 20:22, 14 December 2019 (UTC)
reply
1 -
Bill Dietrich -
wikt:to .500 : winning percentage.
Ira Leviton (
talk ) 20:22, 14 December 2019 (UTC)
reply
1 -
Bill Fennelly -
wikt:a .758 : winning percentage.
Ira Leviton (
talk ) 20:22, 14 December 2019 (UTC)
reply
1 -
Bill Greiner -
wikt:was .500 : winning percentage.
Ira Leviton (
talk ) 20:22, 14 December 2019 (UTC)
reply
1 -
Bill Lochead -
wikt:a .520 : winning percentage.
Ira Leviton (
talk ) 20:22, 14 December 2019 (UTC)
reply
1 -
Bill Muckalt -
wikt:a .950 ; goalie save percentage.
Ira Leviton (
talk ) 03:19, 13 December 2019 (UTC)
reply
2 -
Bill Musselman -
wikt:a .845 ,
wikt:a .656 : winning percentages.
Ira Leviton (
talk ) 03:19, 13 December 2019 (UTC)
reply
2 -
Bill Norman (football manager) -
wikt:a .3768 : winning percentage.
Ira Leviton (
talk ) 20:22, 14 December 2019 (UTC)
reply
1 -
Bill Sharman -
wikt:than .400 : shooting percentage.
Ira Leviton (
talk ) 03:19, 13 December 2019 (UTC)
reply
1 -
Bill Sharsig -
wikt:a .524 : winning percentage.
Ira Leviton (
talk ) 03:19, 13 December 2019 (UTC)
reply
1 -
Bill Tierney -
wikt:of .750 : winning percentage.
Ira Leviton (
talk ) 20:22, 14 December 2019 (UTC)
reply
1 -
Bill Woodcock -
wikt:the .ORG : software jargon.
Ira Leviton (
talk ) 20:22, 14 December 2019 (UTC)
reply
5 -
Billings Outlaws -
wikt:a .500 : winning percentage.
Ira Leviton (
talk ) 21:42, 14 December 2019 (UTC)
reply
1 -
Billy Gillispie -
wikt:finish .500 : winning percentage.
3 -
Billy Murray (baseball) -
wikt:of .585 : winning percentage.
Ira Leviton (
talk ) 21:42, 14 December 2019 (UTC)
reply
1 -
Billy Schaeffer -
wikt:record .594 : shooting percentage.
Ira Leviton (
talk ) 21:42, 14 December 2019 (UTC)
reply
1 -
Binghamton Bearcats men's basketball -
wikt:a .500 : winning percentage.
Ira Leviton (
talk ) 23:05, 14 December 2019 (UTC)
reply
4 -
Binghamton University basketball scandal -
wikt:a .500 : winning percentages.
1 -
Black Knight: The Man Who Guards Me -
wikt:n.CH : the name of a movie studio.
Ira Leviton (
talk ) 15:41, 17 December 2019 (UTC)
reply
2 -
Blacklist (disambiguation) -
wikt:b.LaY : the name of an artist.
Ira Leviton (
talk ) 15:41, 17 December 2019 (UTC)
reply
2 -
Block (permutation group theory) -
wikt:B .x : mathematical jargon.
Ira Leviton (
talk ) 18:07, 17 December 2019 (UTC)
reply
2 -
Blood Lake - re]Search: part of the name "[re]Search my Trash".
Ira Leviton (
talk ) 18:07, 17 December 2019 (UTC)
reply
1 -
Bo Outlaw -
wikt:of .684 : shooting percentage.
Ira Leviton (
talk ) 20:31, 17 December 2019 (UTC)
reply
1 -
Bo Ryan -
wikt:an .820 : winning percentage.
Ira Leviton (
talk ) 20:31, 17 December 2019 (UTC)
reply
2 -
Bo Schembechler -
wikt:of .796 ,
wikt:of .850 : winning percentages.
1 -
Bo Shepard -
wikt:of .812 : winning percentage.
Ira Leviton (
talk ) 20:31, 17 December 2019 (UTC)
reply
7 -
Book of Order -
wikt:PC(USA ,
wikt:PC(USA ,
wikt:PC(USA ,
wikt:PC(USA ,
wikt:PC(USA ,
wikt:section .0300 ,
wikt:part .0004 : all correct; this is the way the Presbyterian Church uses these terms.
Ira Leviton (
talk ) 18:09, 14 December 2019 (UTC)
reply
1 -
Boriding -
wikt:borided : an arcane chemistry term.
Ira Leviton (
talk ) 21:55, 18 December 2019 (UTC)
reply
9 -
Boron porphyrins -
wikt:dipyrromethene)BX ,
wikt:RBOBR(por , phenyl]borate,
wikt:diketonate.The (probably OK:
wikt:monoboryl ,
wikt:diboryl ,
wikt:diboryl ,
wikt:diboryl ,
wikt:diboryl ): chemistry jargon.
Ira Leviton (
talk ) 21:55, 18 December 2019 (UTC)
reply
3 -
Breathalyzer -
wikt:COOH(aq : part of a chemistry formula.
Ira Leviton (
talk ) 20:00, 20 December 2019 (UTC)
reply
1 -
Brian Ford Sullivan -
wikt:series .comEDY : the name of a comedy series.
Ira Leviton (
talk ) 21:37, 20 December 2019 (UTC)
reply
1 -
Broccoli City Festival -
wikt:Anderson .Paak : the name of a band.
Ira Leviton (
talk ) 00:24, 22 December 2019 (UTC)
reply
1 -
Broons -
wikt:i.NB : a German style abbreviation, without a space.
Ira Leviton (
talk )
1 -
Budha Subba Temple -
wikt:you : part of a translation.
Ira Leviton (
talk ) 23:08, 22 December 2019 (UTC)
reply
TS+COMMA+ case notes from 2019-11-20 dump
1 -
Bantu mythology -
wikt:amazimu ,
wikt:madimo : not English, but the language isn't specified so I can't add the proper language tag.
Ira Leviton (
talk ) 17:33, 1 January 2020 (UTC) // at a guess, it's almost certainly Bantu. --
Xurizuri (
talk ) 06:16, 23 January 2021 (UTC)
reply
1 -
Bao Junhui -
wikt:dawn,go ,
wikt:your : in a poem that is quoted.
Ira Leviton (
talk ) 17:33, 1 January 2020 (UTC)
reply
2 -
Benzo(j)fluoranthene -
wikt:chloroethenyl)chrysene ,
wikt:anti-7β,8α-dihydroxy-9α,10α-epoxy-7,8,9,10-tetrahydrobenzo : chemical names.
1 -
Beta-Eleostearic acid -
wikt:octadeca-9,11,13-trienoic : chemical name.
Ira Leviton (
talk ) 02:37, 30 December 2019 (UTC)
reply
1 -
Beta-amyrin 24-hydroxylase -
wikt:amyrin,AH2 : chemical name.
Ira Leviton (
talk ) 02:37, 30 December 2019 (UTC)
reply
3 -
Betulinic acid -
wikt:betulinate : a chemical name.
Ira Leviton (
talk ) 02:37, 30 December 2019 (UTC)
reply
4 -
Bis(5'-adenosyl)-triphosphatase -
wikt:P1,P3 ,
wikt:P1,P3 ,
wikt:P1,P3 : parts of chemistry formulas.
Ira Leviton (
talk ) 03:26, 31 December 2019 (UTC)
reply
5 -
Bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) -
wikt:P1,P4 ,
wikt:P1,P4 ,
wikt:P1,P4 : parts of chemistry formulas.
Ira Leviton (
talk ) 03:26, 31 December 2019 (UTC)
reply
6 -
Bis(5'-nucleosyl)-tetraphosphatase (symmetrical) -
wikt:P1,P4 ,
wikt:P1,P4 ,
wikt:P1,P4 : parts of chemistry formulas.
Ira Leviton (
talk ) 03:26, 31 December 2019 (UTC)
reply
8 -
Butia purpurascens -
wikt:ii,iii ,
wikt:ii,iii ,
wikt:escens - "-escens" is a Latin word ending, not a complete word
Ingratis (
talk ) 18:41, 17 December 2019 (UTC)
reply
T1+
C-Cep
13 -
CCDC130 -
wikt:smagly ,
wikt:smeygly ,
wikt:smawgly ,
wikt:wycho ,
wikt:smagly ,
wikt:smeygly ,
wikt:smawgly ,
wikt:wycho ,
wikt:stygly ,
wikt:zoycho ,
wikt:spogly ,
wikt:glutobu ,
wikt:stygly : names of genes.
Ira Leviton (
talk ) 13:10, 22 August 2020 (UTC)
reply
1 -
CDK-activating kinase -
wikt:cyclinH : the name of a protein.
Ira Leviton (
talk )
3 -
Cable & Deadpool -
wikt:psimitar ,
wikt:venomsaur ,
wikt:psimitar : in-universe words.
Ira Leviton (
talk ) 02:11, 21 August 2020 (UTC)
reply
1 -
California Institute for Telecommunications and Information Technology -
wikt:Cal(IT) : part of an abbreviation.
Ira Leviton (
talk ) 01:26, 22 August 2020 (UTC)
reply
3 -
Calliandra angustifolia -
wikt:capabo ,
wikt:chipero ,
wikt:semein : local names for a plant, but the language isn't mentioned.
Ira Leviton (
talk ) 01:26, 22 August 2020 (UTC)
reply
2 -
Callistophytaceae -
wikt:adpressions : an archaeology term.
Ira Leviton (
talk ) 01:26, 22 August 2020 (UTC)
reply
1 -
Callitrichidae -
wikt:ceboids : monkeys in the family Ceboidae (plural).
Ira Leviton (
talk )
1 -
Caltech Intermediate Form -
wikt:ypos : part of a mathematical formula (i.e., for "y position").
Ira Leviton (
talk ) 01:26, 22 August 2020 (UTC)
reply
4 -
Caltha -
wikt:scalopped ,
wikt:scalopped ,
wikt:pantoporate ,
wikt:codua
2 -
Cam's Delight (1741 ship) - G[eorge],
wikt:eorge : deliberately written as "G[eorge]".
Ira Leviton (
talk ) 16:32, 20 August 2020 (UTC)
reply
2 -
Camp Ondessonk -
wikt:slashies ,
wikt:slashies : an in-universe term.
Ira Leviton (
talk ) 16:32, 20 August 2020 (UTC)
reply
1 -
Cancer Institute of New South Wales -
wikt:eviQ : a name.
Ira Leviton (
talk ) 18:44, 20 August 2020 (UTC)
reply
2 -
Canellaceae -
wikt:intectate ,
wikt:cinnamoil : a botany term and a part of a chemical name.
Ira Leviton (
talk )
3 -
Cantellated 5-cubes -
wikt:sirn ,
wikt:sibrant ,
wikt:gibrant : acronyms, in lower case.
Ira Leviton (
talk ) 18:44, 20 August 2020 (UTC)
reply
2 -
Cantellated 6-orthoplexes -
wikt:srog ,
wikt:siborg : acronyms, in lower case.
Ira Leviton (
talk ) 18:44, 20 August 2020 (UTC)
reply
4 -
Cantellated 8-simplexes -
wikt:srene ,
wikt:sabrene ,
wikt:satrene ,
wikt:gatrene : acronyms, in lower case.
Ira Leviton (
talk ) 18:44, 20 August 2020 (UTC)
reply
3 -
Canut revolts -
wikt:silkers : seems OK.
Ira Leviton (
talk ) 18:44, 20 August 2020 (UTC)
reply
1 -
Carbonyl olefin metathesis -
wikt:alkenation : a type of chemical reaction.
Ira Leviton (
talk ) 03:47, 22 August 2020 (UTC)
reply
5 -
Carborane acid -
wikt:carboranate ,
wikt:pKas ,
wikt:carboranate ,
wikt:carboranate ,
wikt:carboranate : chemistry terms.
Ira Leviton (
talk ) 03:47, 22 August 2020 (UTC)
reply
3 -
Cardiff English -
wikt:dap(per) ,
wikt:fricatised ,
wikt:pluddle : all showing variations of English spoken in Cardiff.
Ira Leviton (
talk ) 03:47, 22 August 2020 (UTC)
reply
1 -
Carltona doctrine -
wikt:juridification : a legal term.
Ira Leviton (
talk ) 14:03, 4 August 2020 (UTC)
reply
1 -
Carnot's theorem (thermodynamics) -
wikt:wcy : a mathematical notation.
Ira Leviton (
talk ) 14:03, 4 August 2020 (UTC)
reply
6 -
Carolus Gallus -
wikt:geloovens ,
wikt:geloovens ,
wikt:effte ,
wikt:apocatypseos ,
wikt:usuque ,
wikt:authoritatib
1 -
Carotol -
wikt:carotane : a chemical name.
Ira Leviton (
talk ) 13:10, 22 August 2020 (UTC)
reply
2 -
Carpal bones -
wikt:intermediale : the name of a bone in certain types of extinct tetrapods.
Ira Leviton (
talk ) 13:10, 22 August 2020 (UTC)
reply
1 -
Carroll (given name) -
wikt:neoichnologist : a legit word.
Ira Leviton (
talk ) 13:10, 22 August 2020 (UTC)
reply
1 -
Carrot -
wikt:gazarin : a chemical name.
Ira Leviton (
talk ) 13:10, 22 August 2020 (UTC)
reply
5 -
Castro culture -
wikt:SUPERTAM(ARICA) ,
wikt:TALABRIC(A) , LADRONU[S], BRA[CA], CASTELL[O]: I reduced the ALLCAPS, but the parentheses and brackets are needed to show missing letters or ambiguity.
Ira Leviton (
talk ) 17:21, 22 August 2020 (UTC)
reply
1 -
Catajapyx aquilonaris -
wikt:entroph : a type of insect.
Ira Leviton (
talk ) 01:16, 21 August 2020 (UTC)
reply
1 -
Catajapyx confusus -
wikt:entroph : a type of insect.
Ira Leviton (
talk ) 01:16, 21 August 2020 (UTC)
reply
1 -
Catajapyx ewingi -
wikt:entroph : a type of insect.
Ira Leviton (
talk ) 01:16, 21 August 2020 (UTC)
reply
1 -
Catajapyx singularis -
wikt:entroph : a type of insect.
Ira Leviton (
talk ) 01:16, 21 August 2020 (UTC)
reply
4 -
Catalan Civil War -
wikt:pactists ,
wikt:foralists ,
wikt:pactists ,
wikt:foralists : political groups ion the Catalan Civil War.
Ira Leviton (
talk ) 17:21, 22 August 2020 (UTC)
reply
1 -
Catalyst 6500 -
wikt:dcef : jargon about the Catalyst 6500.
Ira Leviton (
talk ) 17:21, 22 August 2020 (UTC)
reply
19 -
Category (mathematics) -
wikt:ob(C) ,
wikt:hom(C) ,
wikt:ob(C) ,
wikt:hom(a ,
wikt:homC(a ,
wikt:hom(a ,
wikt:Mor(a ,
wikt:C(a ,
wikt:hom(a ,
wikt:hom(b ,
wikt:hom(a ,
wikt:ob(C) ,
wikt:hom(C) ,
wikt:hom(a ,
wikt:end(a) ,
wikt:aut(a) ,
wikt:hom(a ,
wikt:homC ,
wikt:homset : parts of mathematical formulas.
Ira Leviton (
talk ) 17:21, 22 August 2020 (UTC)
reply
3 -
Catherine de Zegher -
wikt:hemi(cycle) : part of the name of an artwork.
Ira Leviton (
talk ) 17:21, 22 August 2020 (UTC)
reply
1 -
Cathodic protection -
wikt:disbondment : a chemistry term.
Ira Leviton (
talk ) 17:21, 22 August 2020 (UTC)
reply
2 -
Catholic Church sexual abuse cases in Europe -
wikt:juvenate : unclear.
Ira Leviton (
talk ) 17:21, 22 August 2020 (UTC)
reply
1 -
Catocala nymphagoga -
wikt:anthracita : part of a species name?
Ira Leviton (
talk ) 17:21, 22 August 2020 (UTC) // I've added the too technical template, the section is unreadable. --
Xurizuri (
talk ) 11:32, 22 January 2021 (UTC)
reply
7 -
Catuslugi -
wikt:Catusl(o) ,
wikt:Catuslou(gus) ,
wikt:Catus(lougo) ,
wikt:Catuslou(gus) ,
wikt:lougo ,
wikt:slougo ,
wikt:slowgos : showing word derivations.
Ira Leviton (
talk ) 17:21, 22 August 2020 (UTC)
reply
Causative alternation -
wikt:booki - (3a) The booki fell ti (unaccusative)
wikt:initP - initiation phrase (initP)
wikt:procP - process phrase (procP)
wikt:otoshita - Japanese
Cañadón Asfalto Basin -
wikt:padillae ,
wikt:williensis - fossils of various groups of flora and fauna
Cdrtools -
wikt:dvdrecord ,
wikt:readcd ,
wikt:isodebug ,
wikt:isodump ,
wikt:scpio ,
wikt:strar - software-related
Cecropia -
wikt:sub)obovoid - (sub)obovoid // biology stuff. plants. --
Xurizuri (
talk ) 11:32, 22 January 2021 (UTC)
reply
Cell cycle checkpoint -
wikt:cyclinB - primary cyclin utilized is cyclin B.
Celtic sacred trees -
wikt:millpreve - Celtic mythology
wikt:calltuinn - Manx name
wikt:euar - Manx word
Celtic toponymy -
wikt:kwenno - Proto-Celtic *kw enno-
wikt:noviios - Old Celtic noviios 'new'
wikt:nowijo - nowijo- 'new'
wikt:boudo - Containing the elements *boudo- 'victory'
wikt:mogunt - From Celtic *mogunt- , 'mighty, great, powerful'
wikt:temeslos - Possibly from Celtic *tames- 'dark' (cf . Celtic *temeslos
wikt:kamulos - From *kamulos '
Camulus '
Cement -
wikt:cimentum -
hydraulic binder , were later referred to as cementum , cimentum
1 -
Central Atlas Tamazight grammar -
wikt:encliticizes : seems legit.
Ira Leviton (
talk ) 20:40, 4 August 2020 (UTC)
reply
3 -
Central Presbyterian Church (New York City) - <li>, <li>, <li>: I still can't figure out how to fix these.
Ira Leviton (
talk ) 20:40, 4 August 2020 (UTC)
reply
1 -
Cephalopod egg fossil -
wikt:eudemic : a legit word. Not endemic.
Ira Leviton (
talk ) 20:40, 4 August 2020 (UTC)
reply
Cer-Chal
Ceremonial pipe -
wikt:calumel : word used by Norman-French colonisers --
Xurizuri (
talk ) 12:17, 22 January 2021 (UTC)
reply
Cernunnos - C]ernunnos,
wikt:hurnaz : asked for clarification on the talk page as to why [C]ernunnos has the brackets (it's super not clear from the text). *hurnaz is Germanic. --
Xurizuri (
talk ) 12:17, 22 January 2021 (UTC) → reason: it was a quote of an inscription that had first letter damaged. So put in quote marks.
reply
Cerverí de Girona -
wikt:lengatges ,
wikt:leugiers ,
wikt:marritz ,
wikt:puese : some possible mix of Catalan, spanish, italian --
Xurizuri (
talk ) 12:17, 22 January 2021 (UTC)
reply
Cetopsidae -
wikt:cetopsine : Cetopsinae is a subfamily of cetopsidae. a cetopsine belongs to cetopsinae --
Xurizuri (
talk ) 12:17, 22 January 2021 (UTC)
reply
Chak 87 EB -
wikt:mohals : a caste in this pakistan village.--
Xurizuri (
talk ) 12:17, 22 January 2021 (UTC)
reply
Chakhar Mongolian -
wikt:xlar ,
wikt:xnar ,
wikt:lgui : Chakhar is a dialect of Mongolian. These are word fragments.--
Xurizuri (
talk ) 12:17, 22 January 2021 (UTC)
reply
Chalan (music) -
wikt:tivra : foreign language. It'll be a Hindustani one if that helps. --
Xurizuri (
talk ) 12:17, 22 January 2021 (UTC)
reply
Chalcoscirtus -
wikt:chalc : Ancient Greek word fragment
Cham-Chap
Reviewed & ok
Char-Corn
These two are D&D. See notes in Wikipedia:Typo Team/moss/S
11 -
Characters of StarCraft -
wikt:deinfest ,
wikt:deinfestation ,
wikt:deinfestation ,
wikt:terrazine ,
wikt:terrazine ,
wikt:terrazine ,
wikt:deinfestation ,
wikt:infestors ,
wikt:deinfested ,
wikt:deinfested ,
wikt:quillgor : in universe terms.
Ira Leviton (
talk ) 22:22, 23 August 2020 (UTC)
reply
4 -
Chelidonine - benzo[c],
wikt:chelamine : parts of chemical names.
Ira Leviton (
talk ) 16:15, 4 August 2020 (UTC)
reply
2 -
Chemical vapor deposition -
wikt:Si(OC ,
wikt:Cu(hfac) : parts of chemical formulas.
Ira Leviton (
talk ) 16:15, 4 August 2020 (UTC)
reply
1 -
Cherax quinquecarinatus -
wikt:marroning : a local word when fishing for marron, a local fish.
Ira Leviton (
talk ) 16:15, 4 August 2020 (UTC)
reply
1 -
Chex Quest -
wikt:zorchers : an in-universe term.
Ira Leviton (
talk ) 00:48, 24 August 2020 (UTC)
reply
8 -
Chimbu–Wahgi languages -
wikt:am(a ,
wikt:n(o ,
wikt:mo(k ,
wikt:g)Vm ,
wikt:embe(m) , makV[C],
wikt:t(e ,
wikt:makV : there is no ISO 639 code for these languages.
Ira Leviton (
talk ) 14:03, 4 August 2020 (UTC)
reply
1 -
China Airlines Flight 676 -
wikt:whooler : pitch trim apparatus on an airplane.
Ira Leviton (
talk ) 00:48, 24 August 2020 (UTC)
reply
4 -
Chorded keyboard -
wikt:chordic ,
wikt:chordic ,
wikt:chordic ,
wikt:chordic : adjectival form of chord.
Ira Leviton (
talk ) 00:48, 24 August 2020 (UTC)
reply
2 -
Christ II -
wikt:cen(c) ,
wikt:yr(y) : rune markings.
Ira Leviton (
talk ) 14:03, 4 August 2020 (UTC)
reply
1 -
Chrysothallite -
wikt:sanguite - add to wikt
Ingratis (
talk ) 02:22, 16 August 2020 (UTC)
reply
1 -
Cider apple -
wikt:solaxe : a method for planting apples trees.
Ira Leviton (
talk ) 00:44, 19 August 2020 (UTC)
reply
2 -
Ciechocinek Formation -
wikt:prophyritic ,
wikt:crossbed : archaeologic or geologic terms.
Ira Leviton (
talk ) 18:22, 24 August 2020 (UTC)
reply
2 -
Cippus Perusinus - Afun[a],
wikt:laei : quoting from an ancient stone inscription.
Ira Leviton (
talk ) 18:22, 24 August 2020 (UTC)
reply
1 -
Circle of Magic -
wikt:shakken : an in-universe term.
Ira Leviton (
talk ) 18:22, 24 August 2020 (UTC)
reply
1 -
Citizenship Aesthetics -
wikt:aesthetians : I'm not sure if this is a real word.
Ira Leviton (
talk ) 18:22, 24 August 2020 (UTC)
reply
5 -
Citole -
wikt:citula ,
wikt:cistole ,
wikt:cuitole ,
wikt:cytolys : names of the subject of the page in other languages, but the languages are not named.
Ira Leviton (
talk ) 18:22, 24 August 2020 (UTC)
reply
5 -
Citrinin - C]Citrinin: part of a chemical term.
Ira Leviton (
talk ) 18:22, 24 August 2020 (UTC)
reply
2 -
City university test -
wikt:protan ,
wikt:deutran : medical terms.
Ira Leviton (
talk ) 18:22, 24 August 2020 (UTC)
reply
10 -
Civil law notary -
wikt:probativity ,
wikt:improbated ,
wikt:probativity ,
wikt:interlineated ,
wikt:probativity ,
wikt:probativity ,
wikt:notariate ,
wikt:notariate ,
wikt:notariate ,
wikt:notariate : arcane words.
Ira Leviton (
talk ) 18:22, 24 August 2020 (UTC)
reply
3 -
Cizre - <li>, <li>, <li>: I don't know how else to make tables side by side.
Ira Leviton (
talk ) 18:22, 24 August 2020 (UTC)
reply
1 -
Clara Parker (sternwheeler) -
wikt:draying : an old-fashioned but legit word.
Ira Leviton (
talk ) 18:22, 24 August 2020 (UTC)
reply
1 -
Clarinet-cello-piano trio -
wikt:musicaus : in the title of a music work.
Ira Leviton (
talk ) 18:22, 24 August 2020 (UTC)
reply
1 -
Classical compound -
wikt:astrologism : a fringe word, not sure if it's accepted English.
Ira Leviton (
talk ) 01:56, 24 August 2020 (UTC)
reply
4 -
Classical elements in popular culture -
wikt:ambigrammatic ,
wikt:ambigrammatic ,
wikt:elementors ,
wikt:terrakinesis : in universe terms.
Ira Leviton (
talk ) 01:56, 24 August 2020 (UTC)
reply
1 -
Clifton Star Chamber Case -
wikt:impressees : a bit old-fashioned, but legit.
Ira Leviton (
talk ) 16:15, 8 August 2020 (UTC)
reply
2 -
Climont -
wikt:grangiam ,
wikt:grangiam : this article is in the process of translation, best to leave it alone for now.
Ira Leviton (
talk ) 16:15, 8 August 2020 (UTC)
reply
7 -
Clinical metagenomic sequencing -
wikt:destructases : a type of enzyme (plural).
Ira Leviton (
talk ) 16:15, 8 August 2020 (UTC)
reply
2 -
Clinoptilolite -
wikt:Al,Si : part of a chemical formula.
Ira Leviton (
talk ) 16:15, 8 August 2020 (UTC)
reply
34 -
Closure (mathematics) -
wikt:x1,xn ,
wikt:x1,x2 ,
wikt:xi,xi ,
wikt:clref(R) ,
wikt:clsym(R) ,
wikt:cltrn(R) ,
wikt:f(x ,
wikt:f(x ,
wikt:clxxx(R) ,
wikt:clsym(R) ,
wikt:clxxx(R) ,
wikt:cltrn(clsym ,
wikt:clref(R) ,
wikt:cltrn(clemb ,
wikt:clsym(clref ,
wikt:f(b) ,
wikt:f(a) ,
wikt:cltrn(clemb ,
wikt:clsym(clref ,
wikt:cltrn(clsym ,
wikt:clref(R) ,
wikt:difunctionality ,
wikt:difunctionality ,
wikt:clsym ,
wikt:clemb ,
wikt:clsym ,
wikt:clemb ,
wikt:clsym ,
wikt:clemb ,
wikt:clsym ,
wikt:clemb ,
wikt:clsym ,
wikt:clemb ,
wikt:clsym : all mathematical notations or parts of mathematical formulas.
Ira Leviton (
talk ) 01:56, 24 August 2020 (UTC)
reply
18 -
Cnoidal wave -
wikt:K(m) ,
wikt:K(m) ,
wikt:E(m) ,
wikt:K(m) ,
wikt:E(m) ,
wikt:K(m) ,
wikt:E(m) ,
wikt:K(m) ,
wikt:E(m) ,
wikt:sech(z) ,
wikt:cosh(z) ,
wikt:K(m) ,
wikt:E(m) ,
wikt:K(m) ,
wikt:K(m) ,
wikt:K(m) ,
wikt:E(m) ,
wikt:K(m) : all mathematical notations or parts of mathematical formulas.
Ira Leviton (
talk ) 01:56, 24 August 2020 (UTC)
reply
1 -
Cockatoo -
wikt:aviculturally : seems OK.
Ira Leviton (
talk ) 18:28, 25 August 2020 (UTC)
reply
4 -
Codex Alera -
wikt:legionares ,
wikt:legionares ,
wikt:legionnare ,
wikt:watercrafters : in universe terms for this story.
Ira Leviton (
talk ) 18:28, 25 August 2020 (UTC)
reply
1 -
Codex Basilensis A. N. IV. 4 -
wikt:syrp : a type of citation used for codexes.
Ira Leviton (
talk ) 18:28, 25 August 2020 (UTC)
reply
4 -
Codex Ephraemi Rescriptus -
wikt:syrh ,
wikt:syrp ,
wikt:copbo ,
wikt:syrp : a type of citation used for codexes.
Ira Leviton (
talk ) 18:28, 25 August 2020 (UTC)
reply
2 -
Codex Koridethi -
wikt:copbo ,
wikt:syrh : a type of citation used for codexes.
Ira Leviton (
talk ) 18:28, 25 August 2020 (UTC)
reply
4 -
Codex Laudianus -
wikt:syrp ,
wikt:copbo ,
wikt:syrp : a type of citation used for codexes.
Ira Leviton (
talk ) 18:28, 25 August 2020 (UTC)
reply
1 -
Codex Nitriensis -
wikt:copbo : a type of citation used for codexes.
Ira Leviton (
talk ) 18:28, 25 August 2020 (UTC)
reply
1 -
Codex Porphyrianus -
wikt:syrp : a type of citation used for codexes.
Ira Leviton (
talk ) 18:28, 25 August 2020 (UTC)
reply
1 -
Codex Regius (New Testament) -
wikt:copbo : a type of citation used for codexes.
Ira Leviton (
talk ) 18:28, 25 August 2020 (UTC)
reply
2 -
Codex Vaticanus 2061 -
wikt:syrh ,
wikt:copbo : a type of citation used for codexes.
Ira Leviton (
talk ) 18:28, 25 August 2020 (UTC)
reply
3 -
Codex Vercellensis -
wikt:syrp ,
wikt:copbo ,
wikt:copbo : a type of citation used for codexes.
Ira Leviton (
talk ) 18:28, 25 August 2020 (UTC)
reply
2 -
Coeloglossum -
wikt:militarine : name of a chemical.
Ira Leviton (
talk ) 18:28, 25 August 2020 (UTC)
reply
1 -
Coke (fuel) -
wikt:uncoked : seems legit.
Ira Leviton (
talk ) 18:28, 25 August 2020 (UTC)
reply
3 -
Coleraine (barony) - Catha[i], Catha[i]: showing an ambiguous spelling.
Ira Leviton (
talk ) 18:28, 25 August 2020 (UTC)
reply
1 -
Collateralized mortgage obligation -
wikt:notionalized : arcane, but OK.
Ira Leviton (
talk ) 18:28, 25 August 2020 (UTC)
reply
2 -
Colombier, Saint Barthélemy -
wikt:ameives ,
wikt:ardrops : local names for animals on Saint Barthélemy.
Ira Leviton (
talk ) 18:28, 25 August 2020 (UTC)
reply
3 -
Columbia University Marching Band -
wikt:miscies ,
wikt:miscie ,
wikt:miscie : local slang for miscellaneous, not standard English.
Ira Leviton (
talk ) 18:28, 25 August 2020 (UTC)
reply
17 -
Columbus's letter on the first voyage -
wikt:indi(a) ,
wikt:inve(n) ,
wikt:indi(a) ,
wikt:inve(n) ,
wikt:indi(a) ,
wikt:inve(n) ,
wikt:inve ,
wikt:inve ,
wikt:inve : various ambiguously spelled words.
Ira Leviton (
talk ) 18:28, 25 August 2020 (UTC)
reply
3 -
Combustor -
wikt:swirlers ,
wikt:swirlers ,
wikt:swirlers : a legit word.
Ira Leviton (
talk ) 00:45, 25 August 2020 (UTC)
reply
3 -
Common Berthing Mechanism -
wikt:deoutfitting ,
wikt:deberth ,
wikt:deberth : astronaut/NASA jargon.
Ira Leviton (
talk ) 19:36, 24 August 2020 (UTC)
reply
1 -
Common chaffinch -
wikt:chaffinche : a spelling given in one of the citations
3 -
Comparison of Afrikaans and Dutch -
wikt:glassie(n) ,
wikt:koppie(n) ,
wikt:probleempie(n) : showing singular and plural.
Ira Leviton (
talk ) 00:45, 25 August 2020 (UTC)
reply
1 -
Comparison of OpenGL and Direct3D -
wikt:apitest : software jargon.
Ira Leviton (
talk ) 00:45, 25 August 2020 (UTC)
reply
3 -
Comparison of Pascal and Delphi -
wikt:eoln ,
wikt:eoln ,
wikt:eoln : software coding jargon.
Ira Leviton (
talk ) 00:45, 25 August 2020 (UTC)
reply
21 -
Complex polytope -
wikt:g)p , q]p, q]p, p[q],
wikt:r)q ,
wikt:pr(q , p[q], p[q], p[q], p[q], p[q], p[z, q[z, r[z,
wikt:G(p ,
wikt:order(p ,
wikt:order(q ,
wikt:order(p , q[n, p[q], p[q]: parts of mathematical notations.
Ira Leviton (
talk ) 00:45, 25 August 2020 (UTC)
reply
4 -
Complexity class - AM[k], AM[k], AM[k], IP[k]: mathematical notations.
Ira Leviton (
talk ) 00:45, 25 August 2020 (UTC)
reply
3 -
Compounds of fluorine -
wikt:cobalt(V) ,
wikt:dihalogen ,
wikt:fluorocation : chemistry terms.
Ira Leviton (
talk ) 00:45, 25 August 2020 (UTC)
reply
1 -
Compsodrillia tricatenaria -
wikt:appression : a legit word.
Ira Leviton (
talk ) 00:45, 25 August 2020 (UTC)
reply
1 -
Condor Legion Tank Badge -
wikt:reauthorised : British spelling.
Ira Leviton (
talk ) 00:45, 25 August 2020 (UTC)
reply
1 -
Coniine -
wikt:cyanoamide : a chemical name.
Ira Leviton (
talk ) 19:36, 24 August 2020 (UTC)
reply
2 -
Consonant gradation -
wikt:unalternating ,
wikt:unalternating : legit words.
Ira Leviton (
talk ) 19:36, 24 August 2020 (UTC)
reply
1 -
Constitutive equation -
wikt:u(y) : mathematical notation.
Ira Leviton (
talk ) 19:36, 24 August 2020 (UTC)
reply
2 -
Constructive cooperative coevolution -
wikt:SubOpt(pphase ,
wikt:SubOpt(pphase : software code.
Ira Leviton (
talk ) 19:36, 24 August 2020 (UTC)
reply
1 -
Contax -
wikt:lammels
2 -
Continuant (mathematics) -
wikt:K(n) ,
wikt:brcr : mathematical notations.
Ira Leviton (
talk ) 19:36, 24 August 2020 (UTC)
reply
1 -
Continuous and progressive aspects - con]versely,
wikt:versely : brackets used to clarify a quotation.
Ira Leviton (
talk ) 20:57, 25 August 2020 (UTC)
reply
6 -
Contour line -
wikt:f(x ,
wikt:anallobars ,
wikt:isoplats : part of a mathematical formula followed by two meteorological terms.
Ira Leviton (
talk ) 20:57, 25 August 2020 (UTC)
reply
22 -
Contraction (operator theory) -
wikt:Ran(DT) ,
wikt:Ran(DT ,
wikt:Ran(DT) ,
wikt:U(g) ,
wikt:T(t) ,
wikt:U(t) ,
wikt:U(t) ,
wikt:T(t) ,
wikt:U(t) ,
wikt:T(t) ,
wikt:f(T) ,
wikt:f(T) ,
wikt:fr(T) ,
wikt:f(T) ,
wikt:f(T) ,
wikt:fn(T) ,
wikt:f(T) ,
wikt:T(t) ,
wikt:f(T) ,
wikt:B(z) ,
wikt:P(z) ,
wikt:B(z) : parts of mathematical formulas.
Ira Leviton (
talk ) 20:57, 25 August 2020 (UTC)
reply
6 -
Conus ventricosus -
wikt:epaticus ,
wikt:errosus ,
wikt:amigus ,
wikt:emisus ,
wikt:thuscus ,
wikt:elpus : synonyms for Conus ventricosus, but some are not accepted.
Ira Leviton (
talk ) 20:57, 25 August 2020 (UTC)
reply
4 -
Conway polynomial (finite fields) -
wikt:fm(x) ,
wikt:fn(xr) , Fp[x],
wikt:adxd : mathematical formulas.
Ira Leviton (
talk ) 20:57, 25 August 2020 (UTC)
reply
4 -
Cooperative breeding -
wikt:monotocy ,
wikt:monotocy ,
wikt:monotocy : an arcane term used in breeding.
Ira Leviton (
talk ) 20:57, 25 August 2020 (UTC)
reply
1 -
Copolymer -
wikt:B)n : mathematical formula.
Ira Leviton (
talk ) 22:04, 26 August 2020 (UTC)
reply
1 -
Copper -
wikt:copper(IV) : chemistry notation.
Ira Leviton (
talk ) 22:04, 26 August 2020 (UTC)
reply
2 -
Copper in architecture -
wikt:gasketing ,
wikt:gasketing : seems to be a legit word.
Ira Leviton (
talk ) 22:04, 26 August 2020 (UTC)
reply
1 -
Copper(II) carbonate -
wikt:pKso : mathematical formula.
Ira Leviton (
talk ) 22:04, 26 August 2020 (UTC)
reply
4 -
Copper, Bronze and Iron Age sites in Kosovo -
wikt:tholoid : a type of rock formation.
Ira Leviton (
talk ) 22:04, 26 August 2020 (UTC)
reply
7 -
Coptic versions of the Bible -
wikt:copbo ,
wikt:copbo ,
wikt:copbo ,
wikt:copbo ,
wikt:copakh ,
wikt:copbo ,
wikt:syrh : abbreviations for Codexes.
Ira Leviton (
talk ) 22:04, 26 August 2020 (UTC)
reply
1-
Corbitis Atlas -
wikt:y(sole) : unclear.
Ira Leviton (
talk ) 22:04, 26 August 2020 (UTC)
reply
3 -
Cornwall -
wikt:kibbal ,
wikt:lutarist : unclear.
Ira Leviton (
talk ) 22:04, 26 August 2020 (UTC)
reply
6 -
Coroutine - d[produce], d[current],
wikt:libpcl ,
wikt:libaco ,
wikt:fibjs ,
wikt:fibjs : all software jargon.
Ira Leviton (
talk ) 22:11, 23 August 2020 (UTC)
reply
1 -
Corpus Aristotelicum -
wikt:hylomorphs : legit word.
Ira Leviton (
talk ) 22:11, 23 August 2020 (UTC)
reply
10 -
Correspondence of Lorraine toponyms in French and German -
wikt:afisna ,
wikt:avisna ,
wikt:prussification ,
wikt:prussification ,
wikt:prussify ,
wikt:unemphasized : linguistic terms.
Ira Leviton (
talk ) 22:11, 23 August 2020 (UTC)
reply
3 -
Corum Jhaelen Irsei -
wikt:mabden ,
wikt:mabden : an in-universe word.
Ira Leviton (
talk ) 22:11, 23 August 2020 (UTC)
reply
3 -
Cosmic microwave background -
wikt:P(t) ,
wikt:P(t) ,
wikt:P(t) : parts of mathematical formulas.
Ira Leviton (
talk ) 22:11, 23 August 2020 (UTC)
reply
1 -
Courtaulds Red Scar Works Preston -
wikt:coneing : British spelling.
Ira Leviton (
talk ) 19:18, 23 August 2020 (UTC)
reply
8 -
Coxeter notation -
wikt:gcd(p ,
wikt:gcd(p ,
wikt:gcd(p , Y[X], p[q], p[q], p[q], p[r]: mathematical notations.
Ira Leviton (
talk ) 19:18, 23 August 2020 (UTC)
reply
1 -
Crash Canyon -
wikt:buggied : part of the slang term "punch-buggied" (past tense).
Ira Leviton (
talk ) 19:34, 20 August 2020 (UTC)
reply
1 -
Crassulaceae -
wikt:superrosid : a type of plant.
Ira Leviton (
talk ) 19:34, 20 August 2020 (UTC)
reply
1 -
Creativity -
wikt:preinventive : seems legit.
Ira Leviton (
talk ) 19:18, 23 August 2020 (UTC)
reply
5 -
Creode -
wikt:creodes ,
wikt:creodes ,
wikt:creodes ,
wikt:creodes ,
wikt:chreods : plurals and made-up words for the subject of the page, which is also a made-up word.
Ira Leviton (
talk ) 19:18, 23 August 2020 (UTC)
reply
8 -
Creosote -
wikt:phosphotal ,
wikt:eosot ,
wikt:geosot ,
wikt:phosot ,
wikt:creosotal ,
wikt:vaporizor ,
wikt:kreosotum ,
wikt:pKas : chemical names, the last is a chemical/mathematical term.
Ira Leviton (
talk ) 19:18, 23 August 2020 (UTC)
reply
1 -
Crocosphaera watsonii -
wikt:nifX : the name of a gene.
Ira Leviton (
talk ) 14:59, 23 August 2020 (UTC)
reply
3 -
Crohn's disease -
wikt:n(Glc ,
wikt:mannins ,
wikt:nonstricturing : part of a chemical name, a type of molecule, and a word in the title of an article in a medical journal.
Ira Leviton (
talk ) 14:59, 23 August 2020 (UTC)
reply
6 -
Cron -
wikt:dcron ,
wikt:dcron ,
wikt:mcron ,
wikt:mcron ,
wikt:mcron ,
wikt:mcron : variants of the subject of this page.
Ira Leviton (
talk ) 14:59, 23 August 2020 (UTC)
reply
1 -
Cross River National Park -
wikt:gamalin : the generic name of a pesticide.
Ira Leviton (
talk ) 14:59, 23 August 2020 (UTC)
reply
1 -
Cross of Mathilde -
wikt:ABBATI(SSA) : part of an inscription on an ancient stone, with parentheses used for the unreadable part.
Ira Leviton (
talk ) 14:59, 23 August 2020 (UTC)
reply
1 -
Cruising with Ruben & the Jets -
wikt:weazlings : a type of singing? Might not be a real word.
Ira Leviton (
talk ) 14:59, 23 August 2020 (UTC)
reply
2 -
Crusader states -
wikt:cofraternity ,
wikt:balliage : a legit word, and an unclear word.
Ira Leviton (
talk ) 14:59, 23 August 2020 (UTC)
reply
1 -
Cryptographically secure pseudorandom number generator -
wikt:outlen : added a 'clarify' template.
Ira Leviton (
talk ) 14:59, 23 August 2020 (UTC)
reply
3 -
Crêpe (textile) -
wikt:janigor ,
wikt:mosseux ,
wikt:ondese : old trademarked names.
Ira Leviton (
talk ) 14:59, 23 August 2020 (UTC)
reply
1 -
Ctenjapyx boneti -
wikt:entroph : a type of insect.
Ira Leviton (
talk ) 01:16, 21 August 2020 (UTC)
reply
1 -
Ctenjapyx parkeri -
wikt:entroph : a type of insect.
Ira Leviton (
talk ) 01:16, 21 August 2020 (UTC)
reply
1 -
Cugel's Saga -
wikt:draying : an old-fashioned but legit word.
Ira Leviton (
talk ) 01:16, 21 August 2020 (UTC)
reply
1 -
Culchie -
wikt:dulchies : a made up word used for some Irish football fans.
Ira Leviton (
talk ) 02:24, 23 August 2020 (UTC)
reply
2 -
Cult Awareness Network -
wikt:deprogrammee ,
wikt:deprogrammees : someone undergoing deprogramming from a cult (plural):
Ira Leviton (
talk ) 02:24, 23 August 2020 (UTC)
reply
1 -
Culture in Dresden -
wikt:Himmelb(l) : written deliberately.
Ira Leviton (
talk ) 02:24, 23 August 2020 (UTC)
reply
1 -
Culture of Papua New Guinea -
wikt:singsings : a local word.
Ira Leviton (
talk ) 02:24, 23 August 2020 (UTC)
reply
3 -
Culture of Veliko Tarnovo -
wikt:divtation ,
wikt:zohus : unclear.
Ira Leviton (
talk ) 02:24, 23 August 2020 (UTC)
reply
34 -
Cumbrian dialect -
wikt:h)arreet ,
wikt:warm(it ,
wikt:eltr ,
wikt:glisky ,
wikt:gliskr ,
wikt:yakeren ,
wikt:arreet ,
wikt:bevvie ,
wikt:kystie ,
wikt:ladgeful ,
wikt:byuts ,
wikt:byuts ,
wikt:keppards ,
wikt:yhuk ,
wikt:shillies ,
wikt:skemmy ,
wikt:twuk ,
wikt:liggin ,
wikt:gadgey ,
wikt:liggin ,
wikt:glisky ,
wikt:mizzlin ,
wikt:syling ,
wikt:whaarm ,
wikt:whaarm ,
wikt:whure ,
wikt:ahreet ,
wikt:mattttte ,
wikt:thasel ,
wikt:strangba ,
wikt:cluwt ,
wikt:tuwn ,
wikt:yandick ,
wikt:taendick : all Cumbrian dialect, which doesn't have an Iso 693 code.
5 -
Curacin A -
wikt:ACP1,ACP2 ,
wikt:Finally,an ,
wikt:S)HMG ,
wikt:catlyzes ,
wikt:dehydratates
1 -
Curio, Ticino -
wikt:eradicaed : in a quotation; the citation is not online.
Ira Leviton (
talk ) 19:33, 22 August 2020 (UTC)
reply
2 -
Curious George Learns the Alphabet -
wikt:dalg ,
wikt:glidj : made up words in this book.
Ira Leviton (
talk ) 19:33, 22 August 2020 (UTC)
reply
9 -
Curium -
wikt:curium(IV) ,
wikt:americium(V) ,
wikt:curium(IV) ,
wikt:M(II) ,
wikt:curium(IV) ,
wikt:yl)pyridine ,
wikt:curyl : chemistry notations and formulas.
Ira Leviton (
talk ) 19:33, 22 August 2020 (UTC)
reply
2 -
Cushing House -
wikt:euthenic ,
wikt:demonymously : rare but legitimate words.
Ira Leviton (
talk ) 19:33, 22 August 2020 (UTC)
reply
1 -
Cyanogen fluoride -
wikt:nitrilating : a chemistry term.
3 -
Cyathus striatus -
wikt:cyathins ,
wikt:striatins ,
wikt:cyathadonic : a group of different organisms in this genus, a group of related chemicals, and a chemistry term.
Ira Leviton (
talk ) 19:01, 22 August 2020 (UTC)
reply
1 -
Cyberfeminism -
wikt:cyborgian : a legit word.
Ira Leviton (
talk ) 19:01, 22 August 2020 (UTC)
reply
9 -
Cypenamine - (probably OK:
wikt:trans-2-phenylcyclopentan-1-amine ,
wikt:cis-2-phenylcyclopentan-1-amine ,
wikt:trans-2-phenylcyclopentan-1-amine ,
wikt:trans-2-phenylcyclopentan-1-amine ,
wikt:trans-2-phenylcyclopentan-1-amine ,
wikt:trans-2-phenylcyclopentan-1-amine ,
wikt:cis-2-phenylcyclopentan-1-amine ,
wikt:cis-2-phenylcyclopentan-1-amine ,
wikt:cis-2-phenylcyclopentan-1-amine ): chemical names.
Ira Leviton (
talk ) 19:01, 22 August 2020 (UTC)
reply
1 -
Cyrilovite -
wikt:typhylite : a type of mineral or rock.
Ira Leviton (
talk ) 19:01, 22 August 2020 (UTC)
reply
2 -
Cytochrome c family -
wikt:cytC ,
wikt:cytC : genetics or molecular biology abbreviation.
Ira Leviton (
talk ) 19:01, 22 August 2020 (UTC)
reply
TS+DOT
1 -
CDisplay -
wikt:or .cba : OK, explaining a software file extension.
Ira Leviton (
talk ) 01:57, 10 August 2020 (UTC)
reply
1 -
Calliandra surinamensis -
wikt:myrectin : a chemical name.
Ira Leviton (
talk ) 18:44, 9 August 2020 (UTC)
reply
1 -
Camporee -
wikt:camporall : a scouting term.
Ira Leviton (
talk ) 15:53, 9 August 2020 (UTC)
reply
3 -
Canon Court de 105 M(montagne) modèle 1919 Schneider -
wikt:le.GebH ,
wikt:le.GebH ,
wikt:le.GebH : German style abbreviations, with no space after the period.
Ira Leviton (
talk ) 23:19, 8 August 2020 (UTC)
reply
1 -
Cao Fei -
wikt:i.Mirror : the name of an artwork.
Ira Leviton (
talk ) 23:19, 8 August 2020 (UTC)
reply
1 -
Carenzia trispinosa -
wikt:extracarinal : an arcane but legit word.
Ira Leviton (
talk ) 21:32, 8 August 2020 (UTC)
reply
1 -
Carrickfergus Learning Community -
wikt:e.Business : legit use.
Ira Leviton (
talk ) 16:15, 8 August 2020 (UTC)
reply
2 -
Catharanthus roseus -
wikt:leurosine : a chemical name.
Ira Leviton (
talk ) 20:46, 7 August 2020 (UTC)
reply
1 -
Cavall -
wikt:ms.K : an abbreviation.
Ira Leviton (
talk ) 20:46, 7 August 2020 (UTC)
reply
1 -
Cell membrane -
wikt:leptoscope : a device for measuring the thickness of membranes.
1 -
Cephalometric analysis -
wikt:arcial : a legit term.
Ira Leviton (
talk ) 17:30, 7 August 2020 (UTC)
reply
1 -
Chemokine -
wikt:intercrines : a legit term in molecular biology.
Ira Leviton (
talk ) 17:41, 5 August 2020 (UTC)
reply
1 -
Chengam -
wikt:vatunal : unclear.
Ira Leviton (
talk ) 17:41, 5 August 2020 (UTC)
reply
2 -
Chenopodiastrum -
wikt:spicately : a biology term.
Ira Leviton (
talk ) 17:41, 5 August 2020 (UTC)
reply
1 -
Chic McSherry -
wikt:iTravel-Cabo.com : a website.
Ira Leviton (
talk ) 01:19, 5 August 2020 (UTC)
reply
4 -
Chimur -
wikt:prossion ,
wikt:prossion ,
wikt:prossion ,
wikt:prossion . Unclear.
Ira Leviton (
talk ) 20:40, 4 August 2020 (UTC)
reply
3 -
China Railway High-speed -
wikt:A(L) ,
wikt:B(L) ,
wikt:C(L) : Chinese railroad car designations.
Ira Leviton (
talk ) 18:42, 4 August 2020 (UTC)
reply
1 -
Clarion (programming language) -
wikt:clarion.Net : software jargon.
Ira Leviton (
talk ) 19:08, 2 August 2020 (UTC)
reply
3 -
Claw Boys Claw - uga[r], uga[r]: part of "$uga[r]" in a song title.
Ira Leviton (
talk ) 19:08, 2 August 2020 (UTC)
reply
19 -
Coherence (signal processing) -
wikt:x(t) ,
wikt:y(t) ,
wikt:Gxy(f) ,
wikt:Gxx(f) ,
wikt:Gyy(f) ,
wikt:y(t) ,
wikt:x(t) ,
wikt:x(t) ,
wikt:y(t) ,
wikt:h(t) ,
wikt:Y(f) ,
wikt:y(t) ,
wikt:H(f) ,
wikt:x(t) ,
wikt:y(t) ,
wikt:y(t) ,
wikt:x(t) ,
wikt:x(t) ,
wikt:y(t) : parts of mathematical formulas.
Ira Leviton (
talk ) 00:23, 2 August 2020 (UTC)
reply
3 -
Commune -
wikt:communalization : seems legit, meaning the process of communalizing, or forming communes.
Ira Leviton (
talk ) 20:55, 1 August 2020 (UTC)
reply
2 -
Complete dentures -
wikt:decoronation ,
wikt:incisally : dentistry terms.
Ira Leviton (
talk ) 18:44, 1 August 2020 (UTC)
reply
1 -
Complexity Gaming -
wikt:compLexity.Black : the name of a company.
Ira Leviton (
talk ) 18:44, 1 August 2020 (UTC)
reply
1 -
Conjugated estrogens -
wikt:resulfated : a chemistry term.
Ira Leviton (
talk ) 15:31, 1 August 2020 (UTC)
reply
6 -
Constructing skill trees -
wikt:G(t ,
wikt:prior(p ,
wikt:particle(model ,
wikt:particle(current ,
wikt:vector(p ,
wikt:p.MAP : parts of mathematical formulas and software code.
Ira Leviton (
talk ) 14:38, 1 August 2020 (UTC)
reply
4 -
Contorted aromatics -
wikt:P(o , hi]aceanthrylene,
wikt:rubicene ,
wikt:rubicene : parts of chemical names.
Ira Leviton (
talk ) 04:17, 1 August 2020 (UTC)
reply
11 -
Control theory -
wikt:y(t) ,
wikt:r(t) ,
wikt:P(s) ,
wikt:F(s) ,
wikt:Y(s) ,
wikt:R(s) ,
wikt:Y(s) ,
wikt:R(s) ,
wikt:u(t) ,
wikt:y(t) ,
wikt:r(t) : parts of mathematical formulas.
Ira Leviton (
talk ) 04:17, 1 August 2020 (UTC)
reply
2 -
Coonagh, Limerick City -
wikt:gandelows ,
wikt:gandelows : a type of boat (plural).
Ira Leviton (
talk ) 15:03, 30 July 2020 (UTC)
reply
1 -
Cooperia oncophora -
wikt:gelectins : the name of a group of chemicals.
Ira Leviton (
talk ) 15:03, 30 July 2020 (UTC)
reply
1 -
Coprinopsis lagopus -
wikt:lagopodins : the name of a group of chemicals.
Ira Leviton (
talk ) 15:03, 30 July 2020 (UTC)
reply
3 -
Cotlar–Stein lemma -
wikt:T(x) ,
wikt:T(x) : parts of mathematical formulas.
Ira Leviton (
talk ) 16:54, 30 July 2020 (UTC)
reply
1 -
Cppdepend -
wikt:m.CyclomaticComplexity : software coding language.
Ira Leviton (
talk ) 16:54, 30 July 2020 (UTC)
reply
4 -
Cumulative frequency analysis -
wikt:Fg(Lk ,
wikt:Pc(Uk) ,
wikt:Pc(Lk) ,
wikt:t.Sd : parts of mathematical formulas.
Ira Leviton (
talk ) 15:09, 31 July 2020 (UTC)
reply
3 -
Custom Robo (1999 video game) -
wikt:holoseum ,
wikt:holoseum : an in-universe term in this video game.
Ira Leviton (
talk ) 17:30, 31 July 2020 (UTC)
reply
4 -
Cyanography -
wikt:cyanographic ,
wikt:cyanographic ,
wikt:cyanographic : seems legit.
Ira Leviton (
talk ) 19:06, 31 July 2020 (UTC)
reply
2 -
Cyber Anakin -
wikt:ournation-school.com ,
wikt:ournation-school.com : a website.
Ira Leviton (
talk ) 19:06, 31 July 2020 (UTC)
reply
3 -
Cycadales -
wikt:ayrius ,
wikt:pregerminate : a local name for a plant in an unclear aboriginal language, and a botany term.
Ira Leviton (
talk ) 19:06, 31 July 2020 (UTC)
reply
6 -
Cylindrical coordinate system -
wikt:atan(y : part of software code.
Ira Leviton (
talk ) 19:06, 31 July 2020 (UTC)
reply
1 -
Cypher (Spektr album) -
wikt:kl.K : appears to be the name of a musician.
Ira Leviton (
talk ) 19:06, 31 July 2020 (UTC)
reply
TS+COMMA+
C-Cz (except for two with hundreds of entries, left above)
2 -
C space -
wikt:x0,x1 ,
wikt:y1,y2 : mathematical notations.
Ira Leviton (
talk ) 22:25, 18 August 2020 (UTC)
reply
2 -
C19orf70 -
wikt:APOOL,STOML2 ,
wikt:IMMT,MTX1 : names of proteins.
Ira Leviton (
talk ) 22:25, 18 August 2020 (UTC)
reply
24 -
CARINE -
wikt:B1,B2 ,
wikt:R1,B3 ,
wikt:R2,B4 ,
wikt:B1,B2 ,
wikt:R1,B3 ,
wikt:R2,B4 ,
wikt:f(a) ,
wikt:clause(s) ,
wikt:wealthy(Y) ,
wikt:smart(Y) ,
wikt:beautiful(Y) ,
wikt:loves(X ,
wikt:wealthy(Y) ,
wikt:smart(Y) ,
wikt:beautiful(Y) ,
wikt:loves(X ,
wikt:wealthy(Jane) ,
wikt:smart(Jane) ,
wikt:beautiful(Jane) ,
wikt:loves(John ,
wikt:P(x) ,
wikt:Q(a ,
wikt:P(x) ,
wikt:Q(a : parts of mathematical formulas and examples.
Ira Leviton (
talk ) 22:25, 18 August 2020 (UTC)
reply
5 -
CCA tRNA nucleotidyltransferase -
wikt:CTP,CTP ,
wikt:cytidylyl,cytidylyl ,
wikt:CTP(ATP) ,
wikt:ATP(CTP) ,
wikt:adenylyl(cytidylyl) : parts of chemical abbreviations or names.
Ira Leviton (
talk ) 22:25, 18 August 2020 (UTC)
reply
4 -
CEM and SSM chips in synthesizers -
wikt:Saw,Tri ,
wikt:Saw,Tri ,
wikt:VCF,VCA ,
wikt:VCF,VCA : undefined jargon.
Ira Leviton (
talk ) 22:25, 18 August 2020 (UTC)
reply
2 -
CENTAG wartime structure in 1989 -
wikt:Division,note ,
wikt:Forward)note : a superscript, probably could be coded better but I don't know how.
Ira Leviton (
talk ) 22:25, 18 August 2020 (UTC)
reply
1 -
CFR -
wikt:C2,C8 : part of a chemical name.
Ira Leviton (
talk ) 22:25, 18 August 2020 (UTC)
reply
10 -
CIE 1931 color space -
wikt:xmix,ymix ,
wikt:x1,y1 ,
wikt:x2,y2 ,
wikt:xn,yn ,
wikt:xmix,ymix ,
wikt:x1,y1 ,
wikt:x2,y2 ,
wikt:xmix,ymix ,
wikt:x1,y1 ,
wikt:x2,y2 : mathematical notations.
Ira Leviton (
talk ) 22:25, 18 August 2020 (UTC)
reply
1 -
CMP-N-acetylneuraminate monooxygenase -
wikt:acetylneuraminate,ferrocytochrome : part of an enzyme name, correct with no space after the comma.
Ira Leviton (
talk ) 22:25, 18 August 2020 (UTC)
reply
1 -
CORO6 -
wikt:e(EUCOMM) : molecular biology jargon.
Ira Leviton (
talk ) 22:25, 18 August 2020 (UTC)
reply
1 -
CYP8B1 -
wikt:alpha,12 : part of a chemical name.
Ira Leviton (
talk ) 22:25, 18 August 2020 (UTC)
reply
3 -
Calculus (dental) -
wikt:Er,Cr ,
wikt:Er,CR ,
wikt:Er,Cr : an abbreviation for a type of laser.
Ira Leviton (
talk ) 23:12, 12 August 2020 (UTC)
reply
3 -
Calixarene -
wikt:C2v,C4v , calix[n], calix[n]: chemistry abbreviations.
Ira Leviton (
talk ) 23:12, 12 August 2020 (UTC)
reply
2 -
Camera matrix -
wikt:X1,X2 ,
wikt:X1,X2 : mathematical notation.
Ira Leviton (
talk ) 23:12, 12 August 2020 (UTC)
reply
1 -
Camphor 1,2-monooxygenase -
wikt:camphor,reduced : part of an enzyme name, no space after the comma is correct.
Ira Leviton (
talk ) 23:12, 12 August 2020 (UTC)
reply
1 -
Camphor 5-monooxygenase -
wikt:camphor,reduced : ditto.
Ira Leviton (
talk ) 23:12, 12 August 2020 (UTC)
reply
1 -
Cannabinoid -
wikt:dodeca-2E,4E,8Z,10E/Z-tetraenoic-acid-isobutylamide : a chemical name.
Ira Leviton (
talk ) 23:12, 12 August 2020 (UTC)
reply
4 -
Cantor function -
wikt:xk,yk ,
wikt:fn(x) ,
wikt:y(x) ,
wikt:Cz(y) : mathematical notations.
Ira Leviton (
talk ) 23:12, 12 August 2020 (UTC)
reply
1 -
Capacitive deionization -
wikt:Φv,fresh : part of a chemical notation.
Ira Leviton (
talk ) 01:23, 13 August 2020 (UTC)
reply
4 -
Capnellene -
wikt:cis,anti ,
wikt:annululation ,
wikt:hirsutanes : part of a chemical formula and chemistry jargon.
Ira Leviton (
talk ) 01:23, 13 August 2020 (UTC)
reply
2 -
Carbokentbrooksite -
wikt:Na,Ce ,
wikt:NbSiO(Si : parts of chemical formulas.
Ira Leviton (
talk ) 19:35, 12 August 2020 (UTC)
reply
1 -
Carbon-monoxide dehydrogenase (ferredoxin) -
wikt:monoxide,water : this seems to be, correct without a space after a comma.
Ira Leviton (
talk ) 19:35, 12 August 2020 (UTC)
reply
9 -
Carbonate mineral -
wikt:Ni,Mg ,
wikt:Cu,Zn ,
wikt:Zn,Cu ,
wikt:CaFe(CO ,
wikt:CaMg(CO ,
wikt:Ca(CO ,
wikt:CaZn(CO ,
wikt:BaCa(CO ,
wikt:Ca(UO : parts of chemical formulas.
Ira Leviton (
talk ) 19:35, 12 August 2020 (UTC)
reply
1 -
Cardiac action potential -
wikt:Ito,fast : this is part of a medical notation/formula.
Ira Leviton (
talk ) 19:35, 12 August 2020 (UTC)
reply
1 -
Carleman's inequality -
wikt:a1,a2 : part of a mathematical formula.
Ira Leviton (
talk ) 19:35, 12 August 2020 (UTC)
reply
3 -
Carlos Andrés Segovia -
wikt:dwellingness ,
wikt:unworld : arcane terms in philosophy or religion.
Ira Leviton (
talk ) 19:35, 12 August 2020 (UTC)
reply
19 -
Carnot method -
wikt:fF,el ,
wikt:fF,th ,
wikt:fF,el ,
wikt:fF,th ,
wikt:fPE,el ,
wikt:fF,el ,
wikt:fPE,th ,
wikt:fF,th ,
wikt:fF,el ,
wikt:fF,th ,
wikt:ηx,total ,
wikt:ηx,total ,
wikt:ηx,el ,
wikt:ηx,th ,
wikt:ηx,total ,
wikt:ηx,el ,
wikt:ηx,th ,
wikt:ln(TFF ,
wikt:prechain : parts of mathematical formulas and a physics term.
Ira Leviton (
talk ) 19:35, 12 August 2020 (UTC)
reply
6 -
Cartan's criterion -
wikt:ai,aj ,
wikt:j)ai ,
wikt:Tr(b , L[t], tnL[t], C[t]: parts of mathematical formulas.
Ira Leviton (
talk ) 19:35, 12 August 2020 (UTC)
reply
5 -
Cell Transmission Model -
wikt:x0,t0 ,
wikt:x0,t0 ,
wikt:K(x ,
wikt:A(x ,
wikt:q(x : parts of mathematical formulas.
Ira Leviton (
talk ) 23:20, 13 August 2020 (UTC)
reply
8 -
Centre (geometry) -
wikt:ta,tb ,
wikt:f(a ,
wikt:f(b ,
wikt:f(c ,
wikt:f(ta ,
wikt:thf(a ,
wikt:f(a ,
wikt:f(a : parts of mathematical formulas.
Ira Leviton (
talk ) 23:20, 13 August 2020 (UTC)
reply
5 -
Centroid -
wikt:x0,y0 ,
wikt:x1,y1 ,
wikt:Sk(z) ,
wikt:Sy(x) ,
wikt:Sx(y) : parts of mathematical formulas.
Ira Leviton (
talk ) 23:20, 13 August 2020 (UTC)
reply
2 -
Cerastocytin -
wikt:Ile98,Val99 ,
wikt:thrombocytin ,
wikt:thrombocytin : the name of an enzyme.
Ira Leviton (
talk ) 23:20, 13 August 2020 (UTC)
reply
8 -
Cerner CCL -
wikt:i_patient1,cid ,
wikt:echo(build ,
wikt:echo(build ,
wikt:class(c ,
wikt:echo(build ,
wikt:echorecord(c ,
wikt:class(c ,
wikt:echo(build : software coding.
Ira Leviton (
talk ) 23:20, 13 August 2020 (UTC)
reply
2 -
Ceyuan haijing -
wikt:HSYY,KSYV ,
wikt:HNQ,QSK : mathematical notations.
Ira Leviton (
talk ) 23:20, 13 August 2020 (UTC)
reply
22 -
Chain rule for Kolmogorov complexity -
wikt:a1,b1 ,
wikt:a2,b2 ,
wikt:ae,be ,
wikt:a1,b1 ,
wikt:a2,b2 ,
wikt:KP(x ,
wikt:KP(x) ,
wikt:KP(y ,
wikt:I(x ,
wikt:I(y ,
wikt:O(log ,
wikt:K(x ,
wikt:log(K ,
wikt:K(x ,
wikt:K(x ,
wikt:K(y ,
wikt:K(x ,
wikt:K(a ,
wikt:K(x ,
wikt:K(x ,
wikt:K(x ,
wikt:K(x : parts of mathematical formulas.
Ira Leviton (
talk ) 23:20, 13 August 2020 (UTC)
reply
1 -
Chalcone synthase -
wikt:C1,C6 : chemistry notation
Voidify (
talk ) 07:34, 14 August 2020 (UTC)
reply
1 -
Champernowne constant -
wikt:a0,a1 : math notation
Voidify (
talk ) 07:34, 14 August 2020 (UTC)
reply
4 -
Champions of Change (award) -
wikt:LS,Jamshedpur ,
wikt:Godda,Jharkhand ,
wikt:Virudhunagar,Tamilnadu ,
wikt:DM,West
7 -
Chandy–Misra–Haas algorithm resource model -
wikt:Pa,Pb ,
wikt:probe(i ,
wikt:dependentk(i) ,
wikt:dependentk(i) ,
wikt:dependentk(i) ,
wikt:probe(i ,
wikt:O(m : all mathematical jargon or parts of formulas.
Ira Leviton (
talk ) 22:08, 15 August 2020 (UTC)
reply
2 -
Chebyshev–Markov–Stieltjes inequalities -
wikt:P0,P1 ,
wikt:P0,P1 : mathematical notation.
Ira Leviton (
talk ) 17:21, 14 August 2020 (UTC)
reply
4 -
Cheilomenes sexmaculata -
wikt:UUDD,UUDd ,
wikt:UuDD,UuDd ,
wikt:Uudd,UUdd ,
wikt:uuDD,uuDd : genetics jargon.
Ira Leviton (
talk ) 17:21, 14 August 2020 (UTC)
reply
1 -
Chitobiosyldiphosphodolichol beta-mannosyltransferase -
wikt:beta-1,4-D-mannosylchitobiosyldiphosphodolichol : a chemical name.
Ira Leviton (
talk ) 18:55, 14 August 2020 (UTC)
reply
9 -
Chomsky normal form -
wikt:ab,aba ,
wikt:abaa,abab ,
wikt:abac,abb ,
wikt:bab,bac ,
wikt:bb,bc ,
wikt:START,TERM ,
wikt:BIN,DEL ,
wikt:START,BIN ,
wikt:DEL,UNIT : mathematical and software notations.
Ira Leviton (
talk ) 14:27, 15 August 2020 (UTC)
reply
2 -
Chore division -
wikt:E2,E3 ,
wikt:max(E : mathematical notations.
Ira Leviton (
talk ) 14:27, 15 August 2020 (UTC)
reply
1 -
Christophe Bruno -
wikt:Bruno,2417 : part of a url.
Ira Leviton (
talk ) 16:50, 15 August 2020 (UTC)
reply
1 -
Circular points at infinity -
wikt:x0,y0 : mathematical notation.
Ira Leviton (
talk ) 22:42, 15 August 2020 (UTC)
reply
2 -
Circumscribed circle -
wikt:vx,vy : mathematical notation.
Ira Leviton (
talk ) 22:42, 15 August 2020 (UTC)
reply
1 -
Cis-2-enoyl-CoA reductase (NADPH) -
wikt:cis-2,3-dehydroacyl-CoA : a chemical name.
Ira Leviton (
talk ) 22:42, 15 August 2020 (UTC)
reply
1 -
Classic RISC pipeline -
wikt:r10,r3 : software coding.
Ira Leviton (
talk ) 21:04, 16 August 2020 (UTC)
reply
2 -
Clonewheel organ -
wikt:daOrgan : the brand name of an organ (musical instrument).
Ira Leviton (
talk ) 02:24, 16 August 2020 (UTC)
reply
1 -
Closed testing procedure -
wikt:H1,H2 : mathematical notation.
Ira Leviton (
talk ) 02:24, 16 August 2020 (UTC)
reply
6 -
Cluster algebra -
wikt:bx,yby ,
wikt:bx,yby ,
wikt:Q(x , k[x,
wikt:A(S ,
wikt:A(S : mathematical notations.
Ira Leviton (
talk ) 02:24, 16 August 2020 (UTC)
reply
4 -
Cobalt -
wikt:II,III ,
wikt:cobalt(II ,
wikt:cobalt(I) ,
wikt:cobalt(V) : chemical notations.
Ira Leviton (
talk ) 23:12, 16 August 2020 (UTC)
reply
2 -
Cobalt oxide nanoparticle -
wikt:II,III ,
wikt:cobalt(II : chemical notations.
Ira Leviton (
talk ) 23:12, 16 August 2020 (UTC)
reply
6 -
Cognate linkage -
wikt:OA,A1 ,
wikt:OB,B1 ,
wikt:ΔA2,C2 ,
wikt:ΔD,C3 ,
wikt:OC,C2 ,
wikt:ΔOA,OC : mathematical notations.
Ira Leviton (
talk ) 23:12, 16 August 2020 (UTC)
reply
49 -
Cohomology -
wikt:Xα,Aα ,
wikt:Xα,Aα ,
wikt:Xα,Aα ,
wikt:Xα,Aα ,
wikt:ker(di) ,
wikt:im(di ,
wikt:Hi(X ,
wikt:Hi(X ,
wikt:ker(d) ,
wikt:im(d) ,
wikt:ker(d) ,
wikt:im(d) ,
wikt:Hi(X ,
wikt:Hi(X ,
wikt:Hi(X ,
wikt:Hi(X ,
wikt:Hi(X ,
wikt:Hi(X , Z[x], Z[x],
wikt:Hi(X ,
wikt:Hj(Y ,
wikt:j(X ,
wikt:Hi(X ,
wikt:Hj(X ,
wikt:Hi(X ,
wikt:Hj(Y ,
wikt:Hn(X ,
wikt:Hr(X ,
wikt:K(A ,
wikt:Hj(K ,
wikt:K(A ,
wikt:K(Z ,
wikt:Hi(X ,
wikt:Hj(X ,
wikt:i(X ,
wikt:Hn(X ,
wikt:Hi(X ,
wikt:Hi(X ,
wikt:ToriR(M ,
wikt:ExtiR(M ,
wikt:HomR(M ,
wikt:Hi(X ,
wikt:Exti(ZX ,
wikt:Hi(P) ,
wikt:hi(X ,
wikt:hi(A) ,
wikt:hi(A) ,
wikt:hi(A : mathematical notations.
Ira Leviton (
talk ) 23:12, 16 August 2020 (UTC)
reply
13 -
Color vision -
wikt:Wmin,Wmax ,
wikt:Wmin,Wmax ,
wikt:Wmin,Wmax ,
wikt:C(w) ,
wikt:s(w) ,
wikt:m(w) ,
wikt:l(w) ,
wikt:C(w) ,
wikt:s(w) ,
wikt:C(w) ,
wikt:m(w) ,
wikt:C(w) ,
wikt:l(w) : mathematical notations.
Ira Leviton (
talk ) 13:36, 17 August 2020 (UTC)
reply
2 -
Column-oriented DBMS -
wikt:Mary,80000 ,
wikt:Bob,55000 : software coding.
Ira Leviton (
talk ) 13:36, 17 August 2020 (UTC)
reply
12 -
Combinatorial design -
wikt:s1,s2 ,
wikt:BTD(V ,
wikt:BTD(n) ,
wikt:BTD(n) ,
wikt:H(s ,
wikt:L(n ,
wikt:L(n ,
wikt:MD(v ,
wikt:MD(v ,
wikt:MTS(v ,
wikt:PG(n ,
wikt:PG(n : mathematical notations.
Ira Leviton (
talk ) 20:24, 17 August 2020 (UTC)
reply
5 -
Combinatorial number system -
wikt:c2,c1 ,
wikt:c2,c1 ,
wikt:B50,MATCH ,
wikt:INDEX(B ,
wikt:combinadics : mathematical notations, and an arcane but legitimate word.
Ira Leviton (
talk ) 20:24, 17 August 2020 (UTC)
reply
2 -
Common logperch -
wikt:saugeyes : a type of fish (plural).
Ira Leviton (
talk ) 20:24, 17 August 2020 (UTC)
reply
26 -
Complementation of Büchi automaton -
wikt:Q1,Q2 ,
wikt:q1,q2 ,
wikt:q1,q2 ,
wikt:q1,q2 ,
wikt:αp,Q2 ,
wikt:βp,Q1 ,
wikt:Q1,Q2 ,
wikt:f(p) ,
wikt:f(p) ,
wikt:Lf(Lg) ,
wikt:w(i ,
wikt:w(i ,
wikt:w(ij ,
wikt:Lf(Lg) ,
wikt:Lf(Lg) ,
wikt:L(A) ,
wikt:L(A) ,
wikt:L(A) ,
wikt:Lf(Lg) ,
wikt:Lf(Lg) ,
wikt:L(A) ,
wikt:Lf(Lg) ,
wikt:L(A) ,
wikt:L(A) ,
wikt:Lf(Lg) ,
wikt:L(A) : mathematical notations.
Ira Leviton (
talk ) 20:24, 17 August 2020 (UTC)
reply
17 -
Complex logarithm -
wikt:ez,Im ,
wikt:arctan(y ,
wikt:Log(z ,
wikt:L(z) ,
wikt:L(z) ,
wikt:L(ei ,
wikt:L(e ,
wikt:L(z) ,
wikt:L(z) ,
wikt:L(z) ,
wikt:f(a) ,
wikt:Log(z) ,
wikt:L(z) ,
wikt:eg(z) ,
wikt:f(z) ,
wikt:f(z) ,
wikt:f(a) : mathematical notations.
Ira Leviton (
talk ) 20:24, 17 August 2020 (UTC)
reply
7 -
Computability theory -
wikt:y1,y2 ,
wikt:f(n) ,
wikt:f(n) ,
wikt:f(n) ,
wikt:U(p) ,
wikt:A(xk) ,
wikt:f(n) : mathematical notations.
Ira Leviton (
talk ) 20:24, 17 August 2020 (UTC)
reply
2 -
Concise Command Language -
wikt:PROG3,SUB3A ,
wikt:PROG3,SUB3A : software coding.
Ira Leviton (
talk ) 02:02, 18 August 2020 (UTC)
reply
2 -
Concordant pair -
wikt:X1,Y1 ,
wikt:X2,Y2 ]: mathematical notation.
Ira Leviton (
talk ) 02:02, 18 August 2020 (UTC)
reply
1 -
Conditional short-circuit current -
wikt:t0,t1 : mathematical notation.
Ira Leviton (
talk ) 02:02, 18 August 2020 (UTC)
reply
9 -
Condorcet method -
wikt:runner,opponent ,
wikt:opponent,runner ,
wikt:runner,opponent ,
wikt:opponent,runner ,
wikt:runner,opponent ,
wikt:opponent,runner ,
wikt:runner,opponent ,
wikt:opponent,runner ,
wikt:N(N : mathematical notations.
Ira Leviton (
talk ) 02:02, 18 August 2020 (UTC)
reply
1 -
Conjugate gradient method -
wikt:Df(x) : mathematical notation.
Ira Leviton (
talk ) 02:02, 18 August 2020 (UTC)
reply
7 -
Connection form -
wikt:TM,TM ,
wikt:Hom(TM ,
wikt:GL(k) ,
wikt:GLn(C) ,
wikt:n(R) ,
wikt:GL(k) ,
wikt:T(FGE) : mathematical notations.
Ira Leviton (
talk ) 02:02, 18 August 2020 (UTC)
reply
1 -
Conradh na Gaeilge -
wikt:tSratha : unclear.
Ira Leviton (
talk ) 02:02, 18 August 2020 (UTC)
reply
3 -
Construction industry of India -
wikt:stability,high ,
wikt:growth,such ,
wikt:policies,regulations
7 -
Contai -
wikt:sillpo : unclear.
Ira Leviton (
talk ) 02:02, 18 August 2020 (UTC)
reply
20 -
Control table -
wikt:R14,R0 ,
wikt:R0,TRY ,
wikt:R14,R15 ,
wikt:R14,R14 ,
wikt:R14,CT1X ,
wikt:R14,R15 ,
wikt:R14,R14 ,
wikt:R14,CT1X ,
wikt:R15,CT1 ,
wikt:case0,case1 ,
wikt:case2,case3 ,
wikt:default,Add ,
wikt:Subtract,Multiply ,
wikt:X(R ,
wikt:A(DEFAULT) ,
wikt:A(SUBTRACT) ,
wikt:A(DIVIDE) ,
wikt:X(R ,
wikt:A(ADD) ,
wikt:A(MULTIPLY) : mathematical notations.
Ira Leviton (
talk ) 02:02, 18 August 2020 (UTC)
reply
67 -
Controlled Drugs and Substances Act -
wikt:morpholinyl)ethyl , dibenzo[de, g]quinoline,
wikt:propenyl)morphinan ,
wikt:propenyl)morphinan , g]isoquinolin,
wikt:diphenylbutyryl)pyrrolidine ,
wikt:diphenylbutyryl)pyrrolidine ,
wikt:piperidino)piperidine ,
wikt:yl)ethyl , piperidyl]propionanilide,
wikt:thienyl)ethyl ,
wikt:thienyl)ethyl ,
wikt:cyclohexyl)phenol , dibenzo[b, d]pyran, dibenzo[b, d]pyran, dibenzo[b, d]pyran,
wikt:naphthoyl)indole ,
wikt:naphthoyl)indole ,
wikt:naphthoyl)indole ,
wikt:naphthoyl)indole ,
wikt:naphthoyl)indole ,
wikt:naphthoyl)indole ,
wikt:naphthoyl)indole ,
wikt:naphthoyl)indole ,
wikt:naphthoyl)indole ,
wikt:naphthoyl)indole ,
wikt:naphthoyl)indole ,
wikt:naphthoyl)indole ,
wikt:naphthoyl)indole ,
wikt:naphthoyl)indole ,
wikt:naphthoyl)indole ,
wikt:naphthoyl)pyrrole ,
wikt:naphthoyl)pyrrole ,
wikt:iodobenzoyl)indole ,
wikt:morpholinyl)ethyl ,
wikt:yl)acetate ,
wikt:yl)acetate ,
wikt:yl)acetate ,
wikt:yl)acetate ,
wikt:yl)acetate ,
wikt:yl)acetate ,
wikt:yl)acetate ,
wikt:yl)acetate , ethyl]indole, ethyl]indole,
wikt:b)indole ,
wikt:b)indol ,
wikt:aminobutyl)indole ,
wikt:phenylcarbamoyl)sydnone , dibenzo[a, d]cyclohepten,
wikt:yl)amino ,
wikt:yl)barbituric ,
wikt:butenyl)barbituric ,
wikt:diethylamino)propiophenone , a]isoindol, dibenzo[b, dibenzo[b, c]isoxazole, c]pyrazole, a]pyridine, c]pyran,
wikt:l-11-propargyl-1,2,3,9,10,10a-hexahydro-4H-10,4a-iminoethanophenanthren-6-ol : parts of chemical names.
Ira Leviton (
talk ) 02:02, 18 August 2020 (UTC)
reply
8 -
Cooperative MIMO -
wikt:nk,Nk , HKT]T, HKT]T, yKT]T, WKT]T, sKT]T, nKT]T: mathematical notations.
Ira Leviton (
talk ) 15:04, 18 August 2020 (UTC)
reply
2 -
Coordination game -
wikt:Stag,Stag ,
wikt:Hare,Hare : parts of a mathematical formula.
Ira Leviton (
talk ) 15:04, 18 August 2020 (UTC)
reply
9 -
Copper indium gallium selenide solar cells -
wikt:CI(G) ,
wikt:selenization ,
wikt:selenization ,
wikt:selenization ,
wikt:selenization : an arcane abbreviation and an arcane chemistry term.
Ira Leviton (
talk ) 15:04, 18 August 2020 (UTC)
reply
1 -
Corallochytrium -
wikt:palintomic : an arcane scientific term.
Ira Leviton (
talk ) 15:04, 18 August 2020 (UTC)
reply
1 -
Corticosterone 18-monooxygenase -
wikt:corticosterone,reduced : part of the name of an enzyme, correct without a space after the comma.
Ira Leviton (
talk ) 15:04, 18 August 2020 (UTC)
reply
6 -
Courant minimax principle -
wikt:xj,xk ,
wikt:q(x) ,
wikt:q(x) ,
wikt:q(x ,
wikt:q(xk) ,
wikt:q(x) : mathematical notations.
Ira Leviton (
talk ) 15:04, 18 August 2020 (UTC)
reply
1 -
Critical Incident Technique -
wikt:wartime,328 : this is a formatting issue that I don't know how to correct.
Ira Leviton (
talk ) 16:30, 18 August 2020 (UTC)
reply
1 -
Cybersecurity standards -
wikt:COm,TS : marked with clarification needed template.
Ira Leviton (
talk ) 20:00, 18 August 2020 (UTC)
reply
6 -
Cyclic code -
wikt:cn,c1 ,
wikt:c1,c2 ,
wikt:λcn,c1 ,
wikt:Ham(r ,
wikt:Ham(r ,
wikt:Ham(r : mathematical notations.
Ira Leviton (
talk ) 20:00, 18 August 2020 (UTC)
reply
6 -
Cyclophane -
wikt:in,in , n]metacyclophanes, n]paracyclophanes, n]paracyclophane,
wikt:poly(p , n]CPPs: all are chemistry notations or parts of chemical formulas, even the first one.
Ira Leviton (
talk ) 20:00, 18 August 2020 (UTC)
reply
1 -
Cyrtophora exanthematica -
wikt:II,III : edit reverted, with a message that it's correct, with no space after the comma.
Ira Leviton (
talk ) 20:03, 19 August 2020 (UTC)
reply
1 -
Cyrtophora parangexanthematica -
wikt:II,IV : edit reverted, with a message that it's correct, with no space after the comma.
Ira Leviton (
talk ) 20:03, 19 August 2020 (UTC)
reply
1 -
C-MODEM -
wikt:file .BAD : software file suffix.
Ira Leviton (
talk ) 17:56, 19 August 2020 (UTC)
reply
1 -
CAI Format -
wikt:ending .cai : software file suffix.
Ira Leviton (
talk ) 17:56, 19 August 2020 (UTC)
reply
2 -
CD64 (Nintendo) -
wikt:supports .v64 ,
wikt:and .z64 : software file suffixes.
Ira Leviton (
talk ) 17:56, 19 August 2020 (UTC)
reply
6 -
CDemu -
wikt:Creator .cif ,
wikt:WinOnCD .c2d ,
wikt:Modeller .ecm ,
wikt:gBurner .gbi ,
wikt:PowerISO .daa ,
wikt:and .toc : software file suffixes.
Ira Leviton (
talk ) 17:56, 19 August 2020 (UTC)
reply
1 -
CNF -
wikt:extension .cnf : software file suffix.
Ira Leviton (
talk ) 17:56, 19 August 2020 (UTC)
reply
2 -
CP/M -
wikt:translated .ASM ,
wikt:into .A86 : software file suffix.
Ira Leviton (
talk ) 17:56, 19 August 2020 (UTC)
reply
1 -
Caddie (CAD system) -
wikt:ASCII .CEX : software file suffix.
Ira Leviton (
talk ) 17:56, 19 August 2020 (UTC)
reply
1 -
Cadwork informatik AG -
wikt:is .lxz : software file suffix.
Ira Leviton (
talk ) 17:56, 19 August 2020 (UTC)
reply
3 -
Canadian Internet Registration Authority -
wikt:was .kiw ,
wikt:gTLD .mls : software file suffixes.
Ira Leviton (
talk ) 17:56, 19 August 2020 (UTC)
reply
1 -
Cascading (software) -
wikt:Cascading .jars : software file suffix (plural).
Ira Leviton (
talk ) 17:56, 19 August 2020 (UTC)
reply
3 -
Chasys Draw IES -
wikt:the .cd5 ,
wikt:supporting .ggr ,
wikt:and .gra : software file suffixes.
Ira Leviton (
talk ) 16:39, 19 August 2020 (UTC)
reply
1 -
Cheat Engine -
wikt:extension .CT : software file suffix.
Ira Leviton (
talk ) 16:39, 19 August 2020 (UTC)
reply
2 -
Chess opening book (computers) -
wikt:s .ctg ,
wikt:s .abk : software file suffixes.
Ira Leviton (
talk ) 16:39, 19 August 2020 (UTC)
reply
1 -
ChessV -
wikt:in .cvc : software file suffixes.
Ira Leviton (
talk ) 16:39, 19 August 2020 (UTC)
reply
1 -
ChordPro -
wikt:or .cho : software file suffix.
Ira Leviton (
talk ) 16:39, 19 August 2020 (UTC)
reply
4 -
Christian Hartinger -
wikt:Ru(arene) ,
wikt:metal(II) ,
wikt:Am(m) ,
wikt:am(m) : chemistry terminology.
Ira Leviton (
talk ) 16:39, 19 August 2020 (UTC)
reply
1 -
Château de Montségur -
wikt:deBirmingham : a surname.
Ira Leviton (
talk ) 16:39, 19 August 2020 (UTC)
reply
1 -
Citadel (software) -
wikt:be .Read : explaining a software name.
Ira Leviton (
talk ) 01:07, 19 August 2020 (UTC)
reply
1 -
Clinical Data Interchange Standards Consortium -
wikt:as .OWL : a software file suffix.
Ira Leviton (
talk ) 01:07, 19 August 2020 (UTC)
reply
2 -
Clip Studio Paint -
wikt:extension .lip ,
wikt:extension .clip : a software file suffix.
Ira Leviton (
talk ) 01:07, 19 August 2020 (UTC)
reply
3 -
Closed captioning - Games[CC],
wikt:Captionate .XML ,
wikt:a .SCC : software file suffixes.
Ira Leviton (
talk ) 01:07, 19 August 2020 (UTC)
reply
2 -
Clustal -
wikt:with .aln ,
wikt:and .dnd : software file suffixes.
Ira Leviton (
talk ) 01:07, 19 August 2020 (UTC)
reply
2 -
ColdFusion Markup Language -
wikt:the .cfc ,
wikt:as .CFC : software file suffixes.
Ira Leviton (
talk ) 20:03, 19 August 2020 (UTC)
reply
1 -
Combined Community Codec Pack -
wikt:Video .nsv : software file suffix.
Ira Leviton (
talk ) 20:03, 19 August 2020 (UTC)
reply
1 -
Comic book archive -
wikt:or .cb7 : software file suffix.
Ira Leviton (
talk ) 20:03, 19 August 2020 (UTC)
reply
1 -
Commodore 64 peripherals -
wikt:of .d64s : software file suffix.
Ira Leviton (
talk ) 20:03, 19 August 2020 (UTC)
reply
2 -
Commodore D9060 -
wikt:LOAD ,8 ,
wikt:LOAD ,8 : software coding.
Ira Leviton (
talk ) 20:03, 19 August 2020 (UTC)
reply
1 -
Comparison of JavaScript engines (DOM support) -
wikt:and .chOff : software file suffixes.
Ira Leviton (
talk ) 20:03, 19 August 2020 (UTC)
reply
3 -
Comparison of e-book formats -
wikt:Both .xeb ,
wikt:and .ceb ,
wikt:The .ibooks : software jargon and file suffixes.
Ira Leviton (
talk ) 20:03, 19 August 2020 (UTC)
reply
4 -
Component Pascal -
wikt:and .osf ,
wikt:uses .cp ,
wikt:and .cps ,
wikt:format .ocf : software sile suffixes.
Ira Leviton (
talk ) 20:03, 19 August 2020 (UTC)
reply
3 -
Connected Data Objects -
wikt:two .genmodel ,
wikt:load .ecore ,
wikt:to .genmodel : software jargon.
Ira Leviton (
talk ) 20:03, 19 August 2020 (UTC)
reply
1 -
Conway group -
wikt:Let .hkl : mathematical notation.
Ira Leviton (
talk ) 20:03, 19 August 2020 (UTC)
reply
3 -
Creative Music File -
wikt:and .cmf : software file suffix.
Ira Leviton (
talk ) 20:50, 19 August 2020 (UTC)
reply
2 -
Criticism of Google -
wikt:and .tld ,
wikt:and .tld : software file suffixes.
Ira Leviton (
talk ) 20:50, 19 August 2020 (UTC)
reply
13 -
Crowds (anonymity network) -
wikt:P(I ,
wikt:P(Hi) ,
wikt:P(H ,
wikt:P(H ,
wikt:P(H ,
wikt:P(I ,
wikt:P(I ,
wikt:P(H ,
wikt:P(I ,
wikt:P(H ,
wikt:P(IH ,
wikt:P(I ,
wikt:P(I : parts of mathematical notations.
Ira Leviton (
talk ) 20:50, 19 August 2020 (UTC)
reply
1 -
Crown Commercial Service -
wikt:domain .gsi : software file suffix.
Ira Leviton (
talk ) 20:50, 19 August 2020 (UTC)
reply
1 -
CryptMix -
wikt:by .code : software file suffix.
Ira Leviton (
talk ) 20:50, 19 August 2020 (UTC)
reply
2 -
Crystal Reports -
wikt:is .rpt ,
wikt:only .rptr : software file suffix.
Ira Leviton (
talk ) 20:50, 19 August 2020 (UTC)
reply
1 -
Csound -
wikt:extension .csd : software file suffix.
Ira Leviton (
talk ) 20:50, 19 August 2020 (UTC)
reply
2 -
Czech phonology -
wikt:ˈ .ˌ ,
wikt:ˈ .ˌ : unclear.
Ira Leviton (
talk ) 20:50, 19 August 2020 (UTC)
reply
HB+
T1+
4 -
C&C 61 -
wikt:El)iette ,
wikt:Is)abel ,
wikt:Ara)bel ,
wikt:iette (OK: name of the boat is an acronym of)
leela52452 (
talk )
11 -
CMLL Super Viernes (May 2010) - (probably OK:
wikt:rúdo ,
wikt:rúdo ,
wikt:rúdo ,
wikt:rúdo ,
wikt:rúdo ,
wikt:rúdos ,
wikt:rúdo ,
wikt:rúdo ,
wikt:rúdo ,
wikt:rúdos ,
wikt:rúdo ) (note: term used in professional wrestling)
leela52452 (
talk )
2 -
CMLL Torneo Nacional de Parejas Increíbles (2010) - (probably OK:
wikt:rúdo ,
wikt:rúdo ) (note: term used in professional wrestling)
leela52452 (
talk )
1 -
Cadaver Tomb of René of Chalon -
wikt:interrees (note: could not find info)
leela52452 (
talk )
1 -
Cadi (Surselva) -
wikt:cuorts - sursilvan for jurisdiction
Strickesel (
talk )
2 -
Cadmia -
wikt:calamitis
wikt:ostrytis (note: OK: calamitis, ostrytis are terms used in preparation or process of cadmia)
leela52452 (
talk )
4 -
Calabria -
wikt:oceanized ,
wikt:rosamarina ,
wikt:scalidde ,
wikt:nzudda ) rosamarina, scalidde, nzudda are dishes or food. oceanized - word related to geology.
leela52452 (
talk )
2 -
Caladenia toxochila -
wikt:toxon ,
wikt:cheilos toxon, cheilos are greek words
leela52452 (
talk )
1 -
Calakmul -
wikt:ajawob OK: k'ul ajawob, or holy kings.
leela52452 (
talk )
4 -
Calamagrostis stricta -
wikt:filiformed ,
wikt:filiformed ,
wikt:pilosed (probably OK:
wikt:farinosed ) filiformed, farinosed, pilosed -> describes the shape
leela52452 (
talk )
2 -
Calotes pethiyagodai -
wikt:nosilu ,
wikt:katussa Sinhala (local) name: Pethiyagodagë Nosilu Katussa
leela52452 (
talk )
1 -
Calothamnus torulosus -
wikt:phytographica OK: book name - Dissertatio phytographica de Regelia, Beaufortia et Calothamno
leela52452 (
talk )
1 -
Calvary at Pleyben -
wikt:kersanton rock name: La kersantite, ou pierre de Kersanton
leela52452 (
talk )
1 -
Caladenia dilatata -
wikt:koolin - the indigenous name for this plant
Strickesel (
talk )
1 -
Calliostoma javanicum -
wikt:costulated - seems to be a real word
Strickesel (
talk )
1 -
Calochortus albus -
wikt:laceolate - seems to be a real word
Strickesel (
talk )
1 -
Calyptospora -
wikt:decysts - should be a real word
Strickesel (
talk )
7 -
Cambodian units of measurement -
wikt:phyeam ,
wikt:phyeam ,
wikt:sesep ,
wikt:sesep ,
wikt:sesep ,
wikt:sesep ,
wikt:sesep - units of measurement
Strickesel (
talk )
5 -
Cambridge Songs -
wikt:neumed ,
wikt:funebrum ,
wikt:luscinio ,
wikt:perio ,
wikt:simphoniis - first is verb form of neume, rest is latin
Strickesel (
talk )
2 -
Camorra -
wikt:frieno - the name of a statute
Strickesel (
talk )
1 -
Canadian women's ice hockey history -
wikt:collegialism - seems to be okay
Strickesel (
talk )
1 -
Candle (novel) -
wikt:diskster - a term made up for this book
Strickesel (
talk )
2 -
Cannibalism in popular culture -
wikt:daedric - second is a term from skyrim
Strickesel (
talk ) // I can't remember if that's one of the cases when daedric should be capitalised. daedric prince or Daedric prince? --
Xurizuri (
talk ) 03:49, 23 January 2021 (UTC)
reply
1 -
Cantor (music software) -
wikt:elicence OK: elicence dongle: electronic licence authenticator
leela52452 (
talk )
5 -
Canzés dialect -
wikt:cuut ,
wikt:adesinential ,
wikt:cuurt - first and third are words from that dialect, second might not be OK but I can't find the correct word
Strickesel (
talk )
3 -
Canso (song) -
wikt:capcaudadas ,
wikt:capfinidas ,
wikt:unissonans : Old Occitan (probably) words to describe Canso song structures --
Xurizuri (
talk ) 06:17, 7 February 2021 (UTC)
reply
1 -
Capitulations of the Ottoman Empire -
wikt:mouahed - could be okay
Strickesel (
talk )
1 -
Caprinae -
wikt:tsoan species name: tsoan caprids
leela52452 (
talk ) // English language name for them --
Xurizuri (
talk ) 03:49, 23 January 2021 (UTC)
reply
2 -
Carbonyldiimidazole -
wikt:formylized (probably OK:
wikt:triphenylalkelynephosphoranes ) chemical names
leela52452 (
talk )
6 -
Carbonatite -
wikt:fenitization ,
wikt:vermiculte (probably OK:
wikt:alvikite ,
wikt:rauhaugite ,
wikt:beforsite ,
wikt:lengaite ) all terms related to Carbonatite
leela52452 (
talk )
8 -
Carbon footprint -
wikt:openLCA ) openLCA Nexus -> website name
leela52452 (
talk )
3 -
Cardiac neural crest complex -
wikt:midotic ,
wikt:midotic ,
wikt:filopedia - seem to be correct
Strickesel (
talk )
1 -
Carl Friedrich Schmidt (1832) -
wikt:kuckers - estonian oil shale
Strickesel (
talk )
1 -
Carl Heins -
wikt:pianoesque - should be okay
Strickesel (
talk )
1 -
Carnival of Tarazona de la Mancha -
wikt:mascaruta - a costume
Strickesel (
talk )
2 -
Carpal tunnel surgery -
wikt:palamaris - a medical term
Strickesel (
talk )
1 -
Carrier-sense multiple access with collision avoidance -
wikt:desensing - could be okay
Strickesel (
talk )
1 -
Carrycoats -
wikt:cajr - brittonic
Strickesel (
talk )
1 -
Carstairs -
wikt:cajr
2 -
Cash -
wikt:faluce : from a language used on the Indian subcontinent, but I can't tell which language.
Ira Leviton (
talk ) 21:26, 8 January 2020 (UTC)
reply
1 -
Caspian cobra -
wikt:toxinological : the study of snake toxins.
Ira Leviton (
talk ) 21:26, 8 January 2020 (UTC)
reply
2 -
Cat (Unix) -
wikt:demoggification ,
wikt:argn : software jargon.
Ira Leviton (
talk )
1 -
Central India Agency -
wikt:sanads : an unspecified language from the Indian subcontinent. I can't tag it with the right language tag.
Ira Leviton (
talk ) 18:06, 2 January 2020 (UTC)
reply
1 -
Centralizer and normalizer -
wikt:xgx : part of a mathematical formula.
Ira Leviton (
talk ) 18:06, 2 January 2020 (UTC)
reply
1 -
Changsha County -
wikt:glutenite : a type of rock or ore.
Ira Leviton (
talk ) 02:43, 3 January 2020 (UTC)
reply
1 -
Changzhou School of Thought -
wikt:textological : arcane, but OK.
Ira Leviton (
talk ) 02:43, 3 January 2020 (UTC)
reply
2 -
Channel NSW -
wikt:ecoNSW ,
wikt:uTVstar : names of television shows.
Ira Leviton (
talk ) 02:43, 3 January 2020 (UTC)
reply
1 -
Channel S -
wikt:iRonniee : the names of a television show.
Ira Leviton (
talk ) 02:43, 3 January 2020 (UTC)
reply
1 -
Chanté mas -
wikt:lavwa : I'm not sure of this language.
Ira Leviton (
talk ) 02:43, 3 January 2020 (UTC)
reply
2 -
Characterizations of the exponential function -
wikt:limsups ,
wikt:nlna : mathematical jargon.
Ira Leviton (
talk ) 22:26, 3 January 2020 (UTC)
reply
4 -
Chater's Annual -
wikt:rettify ,
wikt:shuggar ,
wikt:raffil ,
wikt:tawker : all song lyrics or titles.
Ira Leviton (
talk ) 05:10, 4 January 2020 (UTC)
reply
1 -
Chemical bonding of H2O -
wikt:unhydridized : an arcane chemistry term.
Ira Leviton (
talk ) 05:10, 4 January 2020 (UTC)
reply
2 -
Chemistry of photolithography -
wikt:poly(cis ,
wikt:silated : chemistry terminology.
Ira Leviton (
talk ) 05:10, 4 January 2020 (UTC)
reply
1 -
Cheri DiNovo -
wikt:erying : written as "Qu(e)erying".
Ira Leviton (
talk ) 05:10, 4 January 2020 (UTC)
reply
1 -
Cherubism -
wikt:malocclusive : dental jargon.
Ira Leviton (
talk ) 05:10, 4 January 2020 (UTC)
reply
1 -
Chief Keef discography -
wikt:upreme : written as $supreme.
Ira Leviton (
talk ) 16:46, 4 January 2020 (UTC)
reply
1 -
Chimurenga -
wikt:reZhou : a name.
Ira Leviton (
talk ) 16:46, 4 January 2020 (UTC)
reply
2 -
Christiane Reppe - (probably OK:
wikt:handbiking ,
wikt:handbiking ): these seem legitimate.
Ira Leviton (
talk ) 01:30, 5 January 2020 (UTC)
reply
2 -
Chuck (engineering) -
wikt:unchucking : an arcane engineering term.
Ira Leviton (
talk ) 03:02, 5 January 2020 (UTC)
reply
1 -
Church of Nossa Senhora da Conceição (Santa Cruz das Flores) -
wikt:polylobal : an architectural or geometrical term.
Ira Leviton (
talk ) 03:02, 5 January 2020 (UTC)
reply
2 -
Church of Nossa Senhora dos Milagres (Corvo) - (probably OK:
wikt:phytomorphic ): an architectural term.
Ira Leviton (
talk ) 03:02, 5 January 2020 (UTC)
reply
1 -
Circular permutation in proteins -
wikt:favin : the name of a protein.
Ira Leviton (
talk ) 07:31, 6 January 2020 (UTC)
reply
1 -
Circular reference -
wikt:posn : software or math jargon.
Ira Leviton (
talk ) 07:31, 6 January 2020 (UTC)
reply
1 -
Clade (novel) -
wikt:clading : a process in this novel.
Ira Leviton (
talk ) 02:27, 2 January 2020 (UTC)
reply
1 -
Clanculus undatus -
wikt:monodont : part of the common name of this mollusk.
Ira Leviton (
talk ) 02:27, 2 January 2020 (UTC)
reply
1 -
Clare Bell -
wikt:hexapodal : this seems like an acceptable spelling.
Ira Leviton (
talk ) 02:27, 2 January 2020 (UTC)
reply
1 -
Clavatula lelieuri -
wikt:bicarinated : arcane, but legit.
Ira Leviton (
talk ) 02:27, 2 January 2020 (UTC)
reply
2 -
Clean (programming language) -
wikt:rgument ,
wikt:cleanlang : written as A(rgument) and software jargon, respectively.
Ira Leviton (
talk ) 02:27, 2 January 2020 (UTC)
reply
1 -
Click letter -
wikt:clickness : maybe not a real word, but it seems OK in context.
Ira Leviton (
talk ) 01:58, 7 January 2020 (UTC)
reply
1 -
Cloudflare -
wikt:cfnts : software jargon.
Ira Leviton (
talk ) 01:58, 7 January 2020 (UTC)
reply
6 -
Coat Corporation -
wikt:danGet ,
wikt:danGet ,
wikt:tarentos ,
wikt:scooop ,
wikt:danGet - "danGet" and "scooop" = proper names; "tarentos" - "tarento" is already plural and a linked WP article
Ingratis (
talk ) 00:35, 8 January 2020 (UTC)
reply
6 -
Cobalt extraction -
wikt:cobalt(II ,
wikt:nickel(II ,
wikt:cobalt(II ,
wikt:alamine - all chemical compounds
Ingratis (
talk ) 00:35, 8 January 2020 (UTC)
reply
1 -
Colby Granger -
wikt:the .45 - this is correct, I believe
Strickesel (
talk )
4 -
Coldzera -
wikt:felps ,
wikt:felps ,
wikt:zews ,
wikt:zews - names of gamers
Strickesel (
talk )
2 -
Cole Hamels -
wikt:at .272 ,
wikt:under .500 - both are correct, I believe
Strickesel (
talk )
2 -
Collect for Purity -
wikt:unspekable ,
wikt:worthilich - both are some kind of Old English
Strickesel (
talk )
1 -
College of Arms -
wikt:scrivened - 'to use a Scrivener'
Strickesel (
talk )
2 -
Colognian declension -
wikt:your - translation of a pronoun of that dialect
Strickesel (
talk )
1 -
Colombo crime family -
wikt:a .357 - this is correct, I believe
Strickesel (
talk )
1 -
Colorado River Numic language -
wikt:pukku - a word in that language
Strickesel (
talk ) // it looks like an attempt to do IPA. I've tagged it with {needs IPA} so someone can come and do it with the IPA template. --
Xurizuri (
talk ) 06:17, 7 February 2021 (UTC)
reply
1 -
Combarbalá -
wikt:combarbalita combarbalita - rock name
leela52452 (
talk )
6 -
Combermere Abbey -
wikt:edifie ,
wikt:your ,
wikt:you ,
wikt:your ,
wikt:your ,
wikt:your text on tablet
leela52452 (
talk )
4 -
Common Operational Datasets -
wikt:cperation ,
wikt:datatset (probably OK:
wikt:cdatasets ,
wikt:datatsets ) COD : Common Operational Datasets
leela52452 (
talk )
1 -
Communist Party of India (Marxist–Leninist) People's War -
wikt:dalams dalams (groups/units)
leela52452 (
talk )
1 -
Community-acquired pneumonia - OK:
wikt:nonpseudomonal )
leela52452 (
talk )
3 -
Compendium of postage stamp issuers (Me–Mz) -
wikt:parale ,
wikt:parale ,
wikt:novcic currency names
leela52452 (
talk )
1 -
Compendium of postage stamp issuers (R) -
wikt:parale
leela52452 (
talk )
7 -
Complete partial order -
wikt:cppos ,
wikt:… ,
wikt:… (probably OK:
wikt:dcpos ,
wikt:dcpos ,
wikt:dcpos ,
wikt:dcpos ) abbreviations
leela52452 (
talk )
7 -
Composite Health Care System -
wikt:with .NET computer language, (OK:
wikt:iEHR ,
wikt:iEHR ) abbreviation
leela52452 (
talk )
1 -
Concordia Association -
wikt:ahongs - seems to be a certain muslim person
Strickesel (
talk )
1 -
Condom -
wikt:spermicidally - legit, I think
Strickesel (
talk )
2 -
Confessor (novel) -
wikt:gobblies - a species in that book
Strickesel (
talk )
3 -
Congruence lattice problem -
wikt:i ,b ,
wikt:i ,z ,
wikt:i ,z - mathematical notations
Strickesel (
talk )
1 -
Conquest of the Canary Islands -
wikt:infernio - italian, I think
Strickesel (
talk )
1 -
Constantin Virgil Gheorghiu -
wikt:machinism - seems to be a real word
Strickesel (
talk )
1 -
Content delivery network -
wikt:mlytics - a brand name
Strickesel (
talk )
1 -
Copyright symbol -
wikt:accedents - seems to be correct
Strickesel (
talk )
2 -
Cosplay -
wikt:cameko ,
wikt:cameko - short form of 'camera kozo'
Strickesel (
talk )
2 -
Cor Fuhler -
wikt:keyolin : a musical instrument that's a combination keyboard and violin.
Ira Leviton (
talk ) 21:56, 9 January 2020 (UTC)
reply
6 -
Coracora -
wikt:Negritos(Entrance ,
wikt:festivitie ,
wikt:ofresen ,
wikt:resivio : I added 'which lang' tags.
Ira Leviton (
talk ) 21:56, 9 January 2020 (UTC)
reply
3 -
Cordia sinensis -
wikt:mnya ,
wikt:qoowe : names for this tree in local languages.
Ira Leviton (
talk ) 21:56, 9 January 2020 (UTC)
reply
29 -
Cornish grammar -
wikt:didn't ,
wikt:he's ,
wikt:here'll ,
wikt:you ,
wikt:kortos ,
wikt:wait.VN ,
wikt:ebost ,
wikt:ynno ,
wikt:ebost ,
wikt:you ,
wikt:wrug ,
wikt:venyn ,
wikt:venyn ,
wikt:gonnyk (probably OK:
wikt:I'm ,
wikt:estyllen ,
wikt:fydh ,
wikt:danvenys ,
wikt:kedhlow ,
wikt:vydh ,
wikt:danvenys ,
wikt:gwelys ,
wikt:lowarth ,
wikt:gwelys ,
wikt:lowarth ,
wikt:dhodho ,
wikt:dhodho ,
wikt:vynnav ,
wikt:kewsel ): all the contractions and non-English (i.e., Cornish) words are correct and used in examples. However, I don't (umm... do not) know how to label the Cornish words because there are different codes for Old, Middle, and Modern Cornish and my Cornish is... a little rusty. They probably can all be labelled 'cor' which is Modern Cornish and the ISO 639-2 code.
Ira Leviton (
talk ) 21:56, 9 January 2020 (UTC) // it's written like it's describing a modern language (it uses present tense, it doesn't say when the language was superceded, and it doesn't compare it to the modern Cornish. --
Xurizuri (
talk ) 06:17, 7 February 2021 (UTC)
reply
2 -
Corosync Cluster Engine -
wikt:confdb (probably OK:
wikt:coroipc ): software jargon.
Ira Leviton (
talk ) 21:56, 9 January 2020 (UTC)
reply
1 -
Cotton gin -
wikt:churka - a type of gin
Strickesel (
talk )
2 -
Count Fenring -
wikt:heighliners - some kind of spaceship
Strickesel (
talk )
1 -
County Sligo -
wikt:bhFionn - an irish word
Strickesel (
talk )
10 -
Court piece -
wikt:bavney ,
wikt:baunie ,
wikt:baunie ,
wikt:baunie ,
wikt:bavney ,
wikt:bavney ,
wikt:bavney ,
wikt:bavney ,
wikt:bavney ,
wikt:baunie - a term in this game
Strickesel (
talk )
1 -
Crash! (manga) -
wikt:vomics = "voice comics" - add to Wikt
Ingratis (
talk ) 00:46, 9 January 2020 (UTC)
reply
2 -
Crónica Electrónica -
wikt:µo ,
wikt:roav - proper names
Ingratis (
talk ) 00:35, 8 January 2020 (UTC)
reply
2 -
Cultured neuronal network - (probably OK:
wikt:neurocages ) - for Wikt
Ingratis (
talk ) 01:39, 5 January 2020 (UTC)
reply
9 -
Curare - (probably OK:
wikt:protocurarine ,
wikt:protocurine ,
wikt:protocuridine ,
wikt:electroplexy ) - all for Wikt
Ingratis (
talk ) 01:39, 5 January 2020 (UTC)
reply
2 -
Cypriot units of measurement -
wikt:kartos (probably OK:
wikt:gomari ) - - both OK: should be in Wiktionary
Ingratis (
talk ) 02:55, 2 January 2020 (UTC)
reply
TS+COMMA+
1 -
Cagayan -
wikt:kayayan (note: not in wiktionary, it means river)
leela52452 (
talk )
1 -
Call site -
wikt:R14,SQR (not sure: seems to be part of code)
leela52452 (
talk )
1 -
Calliostoma gemmulatum - (probably OK:
wikt:lirulae ) (did not find info - but found text "Mazatlan shells" archive.org : "In comparing the words used to describe sculpture (lirae, lirulae, striae, striul^e, &c.) with the same words in other books, they should often be interpreted as to the appearance of the shell under the micro- scope, generally with an inch- achromatic.")
leela52452 (
talk )
1 -
Calliotropis pulchra -
wikt:crenules (OK: Crenules - Small notches or beads. This glossary includes definitions for the technical terminology used in GLANSIS research.
https://www.glerl.noaa.gov/glansis/glossary.html )
leela52452 (
talk )
1 -
Captivity of Kodavas at Seringapatam -
wikt:you : in a quotation.
Ira Leviton (
talk ) 23:13, 12 January 2020 (UTC)
reply
1 -
Carbon-monoxide dehydrogenase (cytochrome b-561) -
wikt:monoxide,water : an enzyme name, properly written without a space after the comma.
Ira Leviton (
talk ) 23:13, 12 January 2020 (UTC)
reply
4 -
Caritas Don Bosco School -
wikt:your ,
wikt:you ,
wikt:you ,
wikt:your : all in a poem.
Ira Leviton (
talk ) 16:48, 12 January 2020 (UTC)
reply
1 -
Catalytically competent protonation state -
wikt:Glu35H,Asp52 : chemistry jargon.
Ira Leviton (
talk ) 03:09, 14 January 2020 (UTC)
reply
4 -
Charmed -
wikt:post)feminism : correctly written (part of a title)
Ira Leviton (
talk ) 02:20, 18 January 2020 (UTC)
reply
2 -
Chiasmus -
wikt:he's ,
wikt:she's : from a quotation.
Ira Leviton (
talk ) 22:52, 18 January 2020 (UTC)
reply
2 -
China–Kazakhstan border -
wikt:E014,G3018 ,
wikt:E012,G30 : road designations.
Ira Leviton (
talk ) 03:45, 19 January 2020 (UTC)
reply
3 -
Chlorothalonil -
wikt:hydroxy-2,5,6-trichloro-1,3-dicyanobenzene (probably OK:
wikt:isophthalonitrile ,
wikt:tetrachloroisophthaloyl ): chemical formulas.
Ira Leviton (
talk ) 14:46, 19 January 2020 (UTC)
reply
3 -
Chortkov (Hasidic dynasty) -
wikt:Sadigura,Kapishnitz ,
wikt:he's ,
wikt:she's - for "Moshe's"
Ingratis (
talk ) 00:44, 20 January 2020 (UTC)
reply
8 -
Colon classification -
wikt:Medicine,Lungs ,
wikt:Medicine,Lungs ,
wikt:Medicine,Lungs ,
wikt:Medicine,Lungs ,
wikt:Medicine,Lungs ,
wikt:Medicine,Lungs ,
wikt:Medicine,Lungs ,
wikt:Medicine,Lungs : writing in a classification system that does not use spaces after commas.
Ira Leviton (
talk ) 14:48, 19 January 2020 (UTC)
reply
1 -
Common control physical channel -
wikt:ch,256 - correct notation
Strickesel (
talk )
3 -
Common pilot channel -
wikt:ch,256 ,
wikt:ch,256 ,
wikt:ch,256 - correct notation
Strickesel (
talk )
4 -
Comparison of TLS implementations -
wikt:rsa,sha256 ,
wikt:rsa,sha1 ,
wikt:rsa,sha1 ,
wikt:rsa,md5 : software coding jargon.
Ira Leviton (
talk ) 15:47, 19 January 2020 (UTC)
reply
19 -
Conflict resolution -
wikt:exists,Strong ,
wikt:can't ,
wikt:haven't ,
wikt:doesn't ,
wikt:don't ,
wikt:your ,
wikt:you ,
wikt:you ,
wikt:you ,
wikt:your ,
wikt:your ,
wikt:you ,
wikt:you ,
wikt:you ,
wikt:you ,
wikt:you ,
wikt:you ,
wikt:you ,
wikt:your : some you/your are in quotations.
Ira Leviton (
talk ) 15:47, 19 January 2020 (UTC)
reply
2 -
Conjugated linoleic acid -
wikt:c9,t11 ,
wikt:t10,c12 : chemistry notation.
Ira Leviton (
talk ) 15:47, 19 January 2020 (UTC)
reply
1 -
Controlled Substances Act -
wikt:repressionistic - might be okay
Strickesel (
talk )
3 -
Convex curve -
wikt:q1,q2 ,
wikt:q1,q2 ,
wikt:s1,s2 - mathematical notations
Strickesel (
talk )
1 -
Correspondence Theatre -
wikt:uncommunicativity - should be okay
Strickesel (
talk )
24 -
Cost-sharing mechanism -
wikt:Alice,George ,
wikt:Alice,Both ,
wikt:George,Both ,
wikt:Alice,Both ,
wikt:George,Both ,
wikt:Payment(Alice ,
wikt:Cost(Both ,
wikt:Cost(Alice ,
wikt:Cost(George ,
wikt:Payment(George ,
wikt:Cost(Both ,
wikt:Cost(George ,
wikt:Cost(Alice ,
wikt:Payment(Alice , median[Cost,
wikt:Cost(Both ,
wikt:Cost(Both ,
wikt:Cost(George ,
wikt:Payment(George , median[Cost,
wikt:Cost(Both ,
wikt:Cost(Both ,
wikt:Cost(Alice ,
wikt:Payment(George - all valid mathematical notations
Strickesel (
talk )
2 -
Countess Vaughn -
wikt:how's ,
wikt:you - 'show's', in a quote
Strickesel (
talk )
1 -
County Government of Nandi -
wikt:murraming - seems to be correct
Strickesel (
talk )
2 -
Cross-polarized wave generation -
wikt:gr,XPW ,
wikt:gr,FW - seem to be correct physics notations
Strickesel (
talk )
1 -
Crotonaldehyde -
wikt:N'-tetramethyl-1,4-butenediamine - chemical notation
Strickesel (
talk )
4 -
Culture of the Bahamas -
wikt:yinna ,
wikt:you ,
wikt:your ,
wikt:your - from that dialect and explanations/translations
Strickesel (
talk )
1 -
CuteCircuit -
wikt:tshirtOS - a brand name
Strickesel (
talk )
1 -
Cutman -
wikt:sub)sulfate - written as (sub)sulfate
Strickesel (
talk )
2 -
Cyclododecatriene -
wikt:cis,trans ,
wikt:cis,trans - chemical notation
Strickesel (
talk )
1 -
Cyclohexane conformation -
wikt:Cis-1,4-Di-tert-butylcyclohexane - chemical notation
Strickesel (
talk )
4 -
Cyclooctadecanonaene -
wikt:cis,trans ,
wikt:cis,trans , methano[10,
wikt:copper(II - all correct chemical notations
Strickesel (
talk )
1 -
Cyclopropanone -
wikt:trans-2,3-di-tert-butylcyclopropanone - chemical notation
Strickesel (
talk )
2 -
César Alonso de las Heras -
wikt:you (probably OK:
wikt:I've ) - both are part of the translation of a song title
Strickesel (
talk )
TS+BRACKETS+
1 -
C10orf76 -
wikt:tm1a(EUCOMM : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
3 -
C11H10 - Methano[10, Methano[10, Methano[10: part of a chemical name.
Ira Leviton (
talk ) 12:18, 27 January 2020 (UTC)
reply
1 -
C15H21NO -
wikt:tolyl)cyclohexanone : part of a chemical name.
Ira Leviton (
talk ) 12:18, 27 January 2020 (UTC)
reply
1 -
C18 -
wikt:cyclo(18 : part of a chemical name.
Ira Leviton (
talk ) 12:18, 27 January 2020 (UTC)
reply
2 -
C18H12CrN3O6 -
wikt:Chromium(III ,
wikt:Chromium(III : parts of a chemical name.
Ira Leviton (
talk ) 12:18, 27 January 2020 (UTC)
reply
1 -
C18H21NO2 -
wikt:naphthyl)piperidine : part of a chemical name.
Ira Leviton (
talk ) 12:18, 27 January 2020 (UTC)
reply
1 -
C1orf38 -
wikt:tm1a(KOMP : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
C21H23NO3 -
wikt:Amylcinnamoyl)anthranilic : chemical name.
Ira Leviton (
talk ) 12:18, 27 January 2020 (UTC)
reply
1 -
C22H12 - Benzo[ghi: chemical name.
Ira Leviton (
talk ) 12:18, 27 January 2020 (UTC)
reply
1 -
C2orf54 -
wikt:tm1a(KOMP : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
4 -
C3a (complement) -
wikt:C3(H2O ,
wikt:C3(H2O ,
wikt:C3b(H2O ,
wikt:desarginine : chemistry notations.
2 -
C4H16Cl3CoN4 -
wikt:cobalt(III ,
wikt:cobalt(III : chemistry notation.
Ira Leviton (
talk ) 19:59, 27 January 2020 (UTC)
reply
1 -
C5orf45 -
wikt:tm1a(EUCOMM : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
2 -
C8orf58 -
wikt:tRNA(fMet : molecular biology notation.
Ira Leviton (
talk ) 19:59, 27 January 2020 (UTC)
reply
1 -
C9orf156 -
wikt:tm1a(EUCOMM : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
CAPRIN2 -
wikt:tm1a(EUCOMM : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
CAPZB -
wikt:tm1a(EUCOMM : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
CARD9 -
wikt:tm1a(EUCOMM : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
CASIC HW-600 series UAV -
wikt:HW(WJ : a model designation.
Ira Leviton (
talk ) 19:59, 27 January 2020 (UTC)
reply
1 -
CBC Sports -
wikt:sublicenced : Canadian spelling.
Ira Leviton (
talk ) 19:59, 27 January 2020 (UTC)
reply
1 -
CBX1 -
wikt:tm1a(EUCOMM : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
CBX7 (gene) -
wikt:tm1a(KOMP : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
5 -
CCC Tam Lee Lai Fun Memorial Secondary School -
wikt:Religion(Christian ,
wikt:Science(Biology ,
wikt:Science(Biology ,
wikt:Education(Elective ,
wikt:Religion(Christian
1 -
CCDC104 -
wikt:tm1a(EUCOMM : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
CCDC137 -
wikt:tm1a(KOMP : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
CCDC57 -
wikt:tm1a(EUCOMM : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
CD97 - Ac[F2: part of molecular biology jargon.
Ira Leviton (
talk ) 19:59, 27 January 2020 (UTC)
reply
2 -
CDH1 (gene) -
wikt:PTPmu(PTPRM ,
wikt:PTPrho(PTPRT : molecular biology terminology.
Ira Leviton (
talk ) 19:59, 27 January 2020 (UTC)
reply
4 -
CDP-ribitol ribitolphosphotransferase -
wikt:poly(ribitol ,
wikt:poly(ribitol ,
wikt:teichoate ,
wikt:teichoate : parts of chemical names.
Ira Leviton (
talk ) 19:59, 27 January 2020 (UTC)
reply
1 -
CDS2 -
wikt:tm1a(KOMP : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
CENPJ -
wikt:tm1a(EUCOMM : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
CENTG2 -
wikt:tm1a(EUCOMM : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
CEPC -
wikt:yl)indoline : chemistry notation.
Ira Leviton (
talk ) 19:59, 27 January 2020 (UTC)
reply
1 -
CFB Toronto -
wikt:RC(AIR : part of a Canadian Air Force designation.
Ira Leviton (
talk ) 15:53, 27 January 2020 (UTC)
reply
1 -
CHD7 -
wikt:tm2a(EUCOMM : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
CHD9 -
wikt:tm1a(EUCOMM : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
CHF -
wikt:Hafnium(IV : chemistry notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
CHRNA5 -
wikt:hetero)pentamers left message on talk page about using (hetero)pentamers
leela52452 (
talk )
1 -
CHST11 -
wikt:tm1a(KOMP : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
2 -
CIB1 -
wikt:alpha(IIb ,
wikt:alpha(IIb : molecular biology notation.
Ira Leviton (
talk ) 15:53, 27 January 2020 (UTC)
reply
1 -
CIR (gene) -
wikt:tm3a(KOMP : molecular biology notation.
Ira Leviton (
talk ) 15:53, 27 January 2020 (UTC)
reply
1 -
CISH -
wikt:tm1a(KOMP : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
CLDN16 -
wikt:tm1a(KOMP : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
CLJ Records - Visual[ism: the name of a music album.
Ira Leviton (
talk ) 15:53, 27 January 2020 (UTC)
reply
1 -
CLUAP1 -
wikt:tm1a(KOMP : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
3 -
CMake -
wikt:sub)directory ,
wikt:pcmaker ,
wikt:pcmaker : software jargon.
Ira Leviton (
talk ) 15:53, 27 January 2020 (UTC)
reply
2 -
CN2 algorithm -
wikt:Find_BestConditionExpression(TrainingSet ,
wikt:Find_BestConditionExpression(TrainingSet : software jargon.
Ira Leviton (
talk ) 15:53, 27 January 2020 (UTC)
reply
1 -
CNBC -
wikt:Dis)Service : part of the name of a program on this channel.
Ira Leviton (
talk ) 15:53, 27 January 2020 (UTC)
reply
1 -
COG2 -
wikt:tm1a(KOMP : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
COL24A1 -
wikt:tm1b(EUCOMM : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
CONRAD (organization) -
wikt:Development(USAID
1 -
COO -
wikt:Cobalt(II : chemistry notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
COQ9 -
wikt:tm1a(KOMP : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
COSE -
wikt:Cobalt(II : chemistry notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
CP Mainali -
wikt:CPN(ML : abbreviation for Communist Party of Nepal, often written without a space.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
CPI(ML) -
wikt:CPI(ML : abbreviation for Communist Party of India, often written without a space.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
CPN(ML) -
wikt:CPN(ML : abbreviation for Communist Party of Nepal, often written without a space.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
CPSF3 -
wikt:tm1b(EUCOMM : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
3 -
CRAM-MD5 -
wikt:md5(something_with_64_bytes ,
wikt:md5_internal(something_with_64_bytes ,
wikt:can't
1 -
CRLF3 -
wikt:tm1a(KOMP : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
CRO -
wikt:Chromium(II : chemistry notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
2 -
CSPD (molecule) - methoxyspiro[adamantane,
wikt:yl)phenyl : both a parts of a chemical formula.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
CSRP2BP -
wikt:tm1a(KOMP : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
CTR9 -
wikt:tm1b(EUCOMM : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
CTTNBP2 -
wikt:tm1b(KOMP : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
CUL4A -
wikt:CRL4(Cdt2 : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
CUO -
wikt:Copper(II : chemistry notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
2 -
CUSIP -
wikt:modulo(10 ,
wikt:modulo(sum : both are part of math jargon.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
CUSO (disambiguation) -
wikt:Copper(II : chemistry notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
CYB561 -
wikt:tm1a(EUCOMM : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
CYB5R3 -
wikt:CH3(CH2 : part of a chemical formula.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
CYP2R1 -
wikt:tm1b(EUCOMM : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
2 -
Cabtaxi number -
wikt:Cabtaxi(10 ,
wikt:Cabtaxi(10 : mathematical notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
1 -
Calabash Nebula -
wikt:sin(angular : mathematical notation.
Ira Leviton (
talk ) 05:00, 25 January 2020 (UTC)
reply
4 -
Calabash chalk -
wikt:geophagical : this word seems legit.
Ira Leviton (
talk ) 05:00, 25 January 2020 (UTC)
reply
1 -
Calamine (mineral) -
wikt:iron(III : chemistry notation.
Ira Leviton (
talk ) 05:00, 25 January 2020 (UTC)
reply
1 -
Calcium chromate -
wikt:chromium(III : chemistry notation.
Ira Leviton (
talk ) 05:00, 25 January 2020 (UTC)
reply
1 -
Calcium disilicide -
wikt:iron(II : chemistry notation.
Ira Leviton (
talk ) 05:00, 25 January 2020 (UTC)
reply
2 -
Calcium phosphate -
wikt:E341(ii ,
wikt:E341(iii : chemistry notation.
Ira Leviton (
talk ) 05:00, 25 January 2020 (UTC)
reply
1 -
Calcium selenide -
wikt:indium(III : chemistry notation.
Ira Leviton (
talk ) 05:00, 25 January 2020 (UTC)
reply
1 -
Calcium sulfate -
wikt:cobalt(II : chemistry notation.
Ira Leviton (
talk ) 05:00, 25 January 2020 (UTC)
reply
1 -
Calculator-Based Laboratory -
wikt:expr(userin : software coding.
Ira Leviton (
talk ) 05:00, 25 January 2020 (UTC)
reply
3 -
Calendar queue - month[11: software jargon.
Ira Leviton (
talk ) 00:59, 26 January 2020 (UTC)
reply
1 -
Calibri -
wikt:Luc(as : written deliberately as "Luc(as)".
Ira Leviton (
talk ) 00:59, 26 January 2020 (UTC)
reply
2 -
Calicene -
wikt:calicenes : plural of the subject of the page.
Ira Leviton (
talk ) 00:59, 26 January 2020 (UTC)
reply
2 -
California Shipbuilding Corporation - Co[mpany (probably OK:
wikt:mpany ): both correct, written deliberately to show errors.
Ira Leviton (
talk ) 00:59, 26 January 2020 (UTC)
reply
4 -
California-Nevada-Hawaii District Key Club International -
wikt:your ,
wikt:your ,
wikt:your ,
wikt:your : these are song lyrics.
Ira Leviton (
talk ) 00:59, 26 January 2020 (UTC)
reply
4 -
Californium -
wikt:californium(III ,
wikt:californium(III : chemistry notation.
Ira Leviton (
talk ) 00:59, 26 January 2020 (UTC)
reply
21 -
Californium compounds -
wikt:californium(III ,
wikt:californium(III ,
wikt:californium(III ,
wikt:californium(III ,
wikt:Californium(IV ,
wikt:californium(IV ,
wikt:californium(II ,
wikt:californium(II ,
wikt:Californium(IV ,
wikt:californium(III ,
wikt:Californium(III ,
wikt:Californium(III ,
wikt:Californium(IV ,
wikt:Californium(II ,
wikt:Californium(III ,
wikt:Californium(III ,
wikt:californium(III ,
wikt:Californium(III ,
wikt:californium(III ,
wikt:Californium(III ,
wikt:Californium(III
3 -
Californium(III) polyborate -
wikt:Californium(III ,
wikt:californium(III ,
wikt:californium(III : chemistry notation.
Ira Leviton (
talk ) 00:59, 26 January 2020 (UTC)
reply
1 -
Camara v. Municipal Court of City and County of San Francisco - examin[ing: in a quotation, as "examin[ing]".
Ira Leviton (
talk ) 23:06, 21 January 2020 (UTC)
reply
1 -
Cambridge Structural Database -
wikt:yl)propan : part of a chemical name.
Ira Leviton (
talk ) 23:06, 21 January 2020 (UTC)
reply
4 -
Camel (chess) -
wikt:LW)b4 ,
wikt:LW)e5 ,
wikt:LW)b5 (probably OK:
wikt:colorboundedness ):chess terminology.
Ira Leviton (
talk ) 23:06, 21 January 2020 (UTC)
reply
3 -
Camp Humphreys -
wikt:Uplus(Mobile ,
wikt:shoppette ,
wikt:shoppette : a type of shop, possibly exclusive to military bases.
Ira Leviton (
talk ) 23:06, 21 January 2020 (UTC)
reply
1 -
Candoluminescence -
wikt:cerium(IV : chemistry jargon.
Ira Leviton (
talk ) 19:51, 19 January 2020 (UTC)
reply
1 -
Candoxatril -
wikt:mannopyranosyl)oxy : part of a chemical formula.
Ira Leviton (
talk ) 19:51, 19 January 2020 (UTC)
reply
3 -
Cannabicyclohexanol -
wikt:yl)phenol ,
wikt:yl)phenyl (probably OK:
wikt:dimethyloctyl ): parts of chemical formulas.
Ira Leviton (
talk )
1 -
Canyon Diablo (meteorite) -
wikt:iron(II : chemical notation.
Ira Leviton (
talk ) 21:47, 19 January 2020 (UTC)
reply
3 -
Capacitor plague -
wikt:aluminum(III : chemistry notation.
Ira Leviton (
talk ) 15:49, 20 January 2020 (UTC)
reply
3 -
Capel Bond - exempl]ary, Ch]ristian,
wikt:ristian : indicating letters that have been eroded on a grave marker.
Ira Leviton (
talk ) 15:49, 20 January 2020 (UTC)
reply
1 -
Capsorubin -
wikt:E160c(ii : a European food additive designation.
Ira Leviton (
talk ) 15:49, 20 January 2020 (UTC)
reply
4 -
Carbene radical -
wikt:cobalt(II ,
wikt:Cobalt(III ,
wikt:cobalt(III ,
wikt:cobalt(II : chemistry notation.
Ira Leviton (
talk ) 15:49, 20 January 2020 (UTC)
reply
1 -
Carbon dioxide removal -
wikt:NaOH(aq : chemistry notation.
Ira Leviton (
talk ) 15:49, 20 January 2020 (UTC)
reply
2 -
Carbon-13 nuclear magnetic resonance -
wikt:Cr(acac ,
wikt:Chromium(III
8 -
Carbonate ester -
wikt:poly(bisphenol ,
wikt:RO(CO ,
wikt:PhO(CO ,
wikt:PhO(CO ,
wikt:PhO(CO ,
wikt:PhO(CO ,
wikt:MeO(CO ,
wikt:Manganese(III : chemistry notations.
Ira Leviton (
talk ) 15:49, 20 January 2020 (UTC)
reply
2 -
Carbonyl reduction -
wikt:LiAl(OtBu ,
wikt:LiBH(Me : chemical formulas.
Ira Leviton (
talk ) 15:49, 20 January 2020 (UTC)
reply
3 -
Carborundum Universal -
wikt:Carbide(RbSiC ,
wikt:Zirconia(YPSZ ,
wikt:Zirconia(MgPSZ : chemical formulas.
Ira Leviton (
talk ) 15:49, 20 January 2020 (UTC)
reply
1 -
Carboxymethyl cellulose -
wikt:CMC(Na : chemical formula.
Ira Leviton (
talk ) 15:49, 20 January 2020 (UTC)
reply
1 -
Cardiff (disambiguation) -
wikt:What(ever : part of a song title.
Ira Leviton (
talk ) 16:12, 20 January 2020 (UTC)
reply
1 -
Cardus Education Survey Canada -
wikt:you : in a quotation.
Ira Leviton (
talk ) 16:12, 20 January 2020 (UTC)
reply
1 -
Caridina apodosis -
wikt:B1ab(iii : a criteria of the International Union for Conservation of Nature for evaluating endangered animals.
Ira Leviton (
talk ) 16:12, 20 January 2020 (UTC)
reply
1 -
Caridina linduensis -
wikt:B1ab(iii : ditto.
Ira Leviton (
talk ) 16:12, 20 January 2020 (UTC)
reply
1 -
Carl Axel Arrhenius -
wikt:Yttrium(III : chemistry notation.
Ira Leviton (
talk ) 19:56, 20 January 2020 (UTC)
reply
1 -
Carl Franz Anton Ritter von Schreibers -
wikt:Ni)3P : chemistry notation.
Ira Leviton (
talk ) 19:56, 20 January 2020 (UTC)
reply
2 -
Carl Shipp Marvel -
wikt:Poly(para : chemistry notation.
Ira Leviton (
talk ) 19:56, 20 January 2020 (UTC)
reply
1 -
Carl Wilhelm Scheele -
wikt:manganese(IV : chemistry notation.
Ira Leviton (
talk ) 19:56, 20 January 2020 (UTC)
reply
1 -
Carl von Heyden -
wikt:Georg(es : written that way, I assume because of some doubt about the proper form of the name.
Ira Leviton (
talk ) 19:56, 20 January 2020 (UTC)
reply
2 -
Carlos Bulosan Theatre -
wikt:Orient(ed : in the title of a play.
Ira Leviton (
talk ) 19:56, 20 January 2020 (UTC)
reply
1 -
Carlos Cruz-Diez -
wikt:In)formed : in the name of an art exhibition.
Ira Leviton (
talk ) 19:56, 20 January 2020 (UTC)
reply
1 -
Carminite -
wikt:lead(II : chemistry notation.
Ira Leviton (
talk ) 02:43, 21 January 2020 (UTC)
reply
1 -
Carnitine biosynthesis -
wikt:iron(II : chemistry notation.
Ira Leviton (
talk ) 02:43, 21 January 2020 (UTC)
reply
1 -
Carnitine palmitoyltransferase II -
wikt:tm1b(KOMP : chemistry notation.
Ira Leviton (
talk ) 02:43, 21 January 2020 (UTC)
reply
1 -
Carnitine-acylcarnitine translocase -
wikt:tm1a(EUCOMM : chemistry notation.
Ira Leviton (
talk ) 02:43, 21 January 2020 (UTC)
reply
1 -
Carson High School (Carson, California) -
wikt:flaggies : unclear.
Ira Leviton (
talk ) 03:41, 26 January 2020 (UTC)
reply
3 -
Carstairs railway station -
wikt:remarshalled - "remarshalled" is OK -
Jkgree (
talk ) 18:59, 21 January 2020 (UTC)
reply
1 -
Carveol -
wikt:yl)cyclohex : chemical notation.
Ira Leviton (
talk ) 03:41, 26 January 2020 (UTC)
reply
1 -
Catalase -
wikt:copper(II : chemical notation.
Ira Leviton (
talk ) 01:25, 24 January 2020 (UTC)
reply
2 -
Catalogues of Fundamental Stars -
wikt:FK6(III ,
wikt:FK6(III : abbreviation for a book title.
Ira Leviton (
talk )
2 -
Catalysis -
wikt:RhCl(PPh ,
wikt:lead(II : chemical notation.
Ira Leviton (
talk ) 01:25, 24 January 2020 (UTC)
reply
6 -
Catalytic chain transfer -
wikt:metha)acrylate ,
wikt:cobalt(II ,
wikt:Co(por ,
wikt:cobalt(II ,
wikt:cobalt(III ,
wikt:polymeryl : parts of chemical names and notations.
Ira Leviton (
talk ) 01:25, 24 January 2020 (UTC)
reply
3 -
Catechol 1,2-dioxygenase -
wikt:iron(III : chemical notation.
Ira Leviton (
talk ) 01:25, 24 January 2020 (UTC)
reply
4 -
Catecholborane -
wikt:tris(catecholato : part of a chemical name.
Ira Leviton (
talk ) 01:25, 24 January 2020 (UTC)
reply
1 -
Category of relations -
wikt:Rel(FA : mathematical notations.
Ira Leviton (
talk ) 01:25, 24 January 2020 (UTC)
reply
2 -
Category of topological spaces -
wikt:co)limits ,
wikt:co)limits : mathematical notations.
Ira Leviton (
talk ) 01:25, 24 January 2020 (UTC)
reply
2 -
Category of topological vector spaces -
wikt:co)complete ,
wikt:co)complete : mathematical notations.
Ira Leviton (
talk ) 01:25, 24 January 2020 (UTC)
reply
2 -
Catellani reaction -
wikt:arylpalladium(II ,
wikt:rhazinal : chemical names.
Ira Leviton (
talk ) 01:25, 24 January 2020 (UTC)
reply
2 -
Cathy Henkel -
wikt:you ,
wikt:you : part of a title.
Ira Leviton (
talk ) 01:25, 24 January 2020 (UTC)
reply
1 -
Cativa process -
wikt:iridium(III : chemical notation.
Ira Leviton (
talk ) 01:25, 24 January 2020 (UTC)
reply
9 -
Caturix - IN[ST: deliberately written, part of "IN[ST]ITVIT".
Ira Leviton (
talk ) 01:25, 24 January 2020 (UTC)
reply
1 -
Cavalry tactics -
wikt:kissaiers : I'm not sure of the language.
Ira Leviton (
talk ) 03:08, 29 January 2020 (UTC)
reply
2 -
Cedros Island - (probably OK:
wikt:megaherbivoreless ): rephrased to megaherbivore.
Ira Leviton (
talk ) 03:08, 29 January 2020 (UTC)
reply
1 -
Centaurin, alpha 1 -
wikt:tm1a(EUCOMM : genetic jargon.
Ira Leviton (
talk ) 16:15, 25 January 2020 (UTC)
reply
1 -
Center for Architecture and Design -
wikt:Park(ing : part of a title.
Ira Leviton (
talk ) 16:15, 25 January 2020 (UTC)
reply
59 -
Central Organising Committee, Communist Party of India (Marxist–Leninist) -
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:UCCRI(ML ,
wikt:CPI(ML ,
wikt:UCCRI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:UCCRI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML : abbreviatin for Communist Party of India (Marxist-Leninist) and other Marxist Leninist parties.
Ira Leviton (
talk ) 19:50, 28 January 2020 (UTC)
reply
2 -
Central Organising Committee, Communist Party of India (Marxist–Leninist) (Umadhar Singh) -
wikt:CPI(ML ,
wikt:COI(ML : ditto.
Ira Leviton (
talk ) 19:50, 28 January 2020 (UTC)
reply
4 -
Central Organising Committee, Communist Party of India (Marxist–Leninist) Shantipal -
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML : ditto.
Ira Leviton (
talk ) 19:50, 28 January 2020 (UTC)
reply
14 -
Central Reorganisation Committee, Communist Party of India (Marxist–Leninist) -
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML : ditto.
Ira Leviton (
talk ) 19:50, 28 January 2020 (UTC)
reply
5 -
Centre of Communist Revolutionaries of India -
wikt:UCCRI(ML ,
wikt:CPI(ML ,
wikt:CPI(ML ,
wikt:UCCRI(ML ,
wikt:CPI(ML : ditto.
Ira Leviton (
talk ) 19:50, 28 January 2020 (UTC)
reply
2 -
Cephalosporin-C transaminase -
wikt:oxopentanoyl)aminocephalosporinate ,
wikt:oxopentanoyl)aminocephalosporinate : chemistry notation.
Ira Leviton (
talk ) 16:38, 28 January 2020 (UTC)
reply
13 -
Ceramic glaze -
wikt:Lead(II ,
wikt:lead(II ,
wikt:Lead(II ,
wikt:lead(II ,
wikt:Chromium(III ,
wikt:Chromium(III ,
wikt:Chromium(III ,
wikt:Chromium(VI ,
wikt:Chromium(VI ,
wikt:chromium(III ,
wikt:chromium(VI ,
wikt:chromium(VI : chemistry notation.
Ira Leviton (
talk ) 16:38, 28 January 2020 (UTC)
reply
1 -
Ceramic matrix composite -
wikt:poly)crystalline : chemistry notation.
Ira Leviton (
talk ) 16:38, 28 January 2020 (UTC)
reply
1 -
Ceria-zirconia -
wikt:cerium(IV : chemistry notation.
Ira Leviton (
talk ) 16:38, 28 January 2020 (UTC)
reply
1 -
Cerimetry -
wikt:cerium(IV : chemistry notation.
Ira Leviton (
talk ) 16:38, 28 January 2020 (UTC)
reply
2 -
Cerium hydroxide -
wikt:Cerium(III ,
wikt:Cerium(IV : chemistry notations.
Ira Leviton (
talk ) 16:38, 28 January 2020 (UTC)
reply
20 -
Cerium nitrate -
wikt:Cerium(III ,
wikt:cerium(III ,
wikt:cerium(III ,
wikt:cerium(III ,
wikt:diaquapentanitratocerate(III ,
wikt:Cerium(IV ,
wikt:cerium(IV ,
wikt:cerium(IV ,
wikt:cerium(IV ,
wikt:diaquapentanitratocerate(III ,
wikt:CeM(II ,
wikt:thallium(III : chemistry notations.
Ira Leviton (
talk ) 16:38, 28 January 2020 (UTC)
reply
4 -
Cerium oxalate -
wikt:Cerium(III ,
wikt:cerium(III ,
wikt:Cerium(III ,
wikt:Cerium(III : chemistry notation.
Ira Leviton (
talk ) 16:38, 28 January 2020 (UTC)
reply
3 -
Cerium oxide -
wikt:Cerium(III ,
wikt:Cerium(III ,
wikt:Cerium(IV : chemistry notation.
Ira Leviton (
talk ) 16:38, 28 January 2020 (UTC)
reply
10 -
Cerium uranium blue -
wikt:cerium(IV ,
wikt:uranium(IV ,
wikt:cerium(III ,
wikt:cerium(IV ,
wikt:uranium(IV ,
wikt:cerium(IV ,
wikt:uranium(IV ,
wikt:cerium(IV ,
wikt:uranium(VI ,
wikt:cerium(III : chemistry notation.
Ira Leviton (
talk ) 16:38, 28 January 2020 (UTC)
reply
1 -
Cerium(III) bromide -
wikt:Cerium(III : chemistry notation.
Ira Leviton (
talk ) 16:38, 28 January 2020 (UTC)
reply
6 -
Cerium(III) carbonate -
wikt:Cerium(III ,
wikt:cerium(III ,
wikt:cerium(III ,
wikt:Cerium(III ,
wikt:Cerium(III ,
wikt:cerium(III : chemistry notation.
Ira Leviton (
talk ) 16:38, 28 January 2020 (UTC)
reply
3 -
Cerium(III) chloride -
wikt:Cerium(III ,
wikt:Cerium(III ,
wikt:cerium(III : chemistry notation.
Ira Leviton (
talk ) 16:38, 28 January 2020 (UTC)
reply
1 -
Cerium(III) fluoride -
wikt:Cerium(III : chemistry notation.
Ira Leviton (
talk ) 16:38, 28 January 2020 (UTC)
reply
2 -
Cerium(III) hydroxide -
wikt:Cerium(III ,
wikt:Cerium(III : chemistry notation.
Ira Leviton (
talk ) 16:38, 28 January 2020 (UTC)
reply
4 -
Cerium(III) iodide -
wikt:Cerium(III ,
wikt:cerium(III ,
wikt:cerium(III ,
wikt:Cerium(III : chemistry notation.
Ira Leviton (
talk ) 16:38, 28 January 2020 (UTC)
reply
4 -
Cerium(III) methanesulfonate -
wikt:Cerium(III ,
wikt:cerium(III ,
wikt:Cerium(III ,
wikt:cerium(IV : chemistry notation.
Ira Leviton (
talk ) 16:38, 28 January 2020 (UTC)
reply
16 -
Cerium(III) oxide -
wikt:Cerium(III ,
wikt:cerium(IV ,
wikt:cerium(III ,
wikt:cerium(III ,
wikt:cerium(IV ,
wikt:cerium(III ,
wikt:cerium(IV ,
wikt:cerium(III ,
wikt:cerium(IV ,
wikt:cerium(III ,
wikt:Cerium(III ,
wikt:tin(II ,
wikt:cerium(III ,
wikt:tin(II ,
wikt:Cerium(III ,
wikt:cerium(IV : chemistry notation.
Ira Leviton (
talk ) 16:38, 28 January 2020 (UTC)
reply
1 -
Cerium(III) sulfate -
wikt:Cerium(III : chemistry notation.
Ira Leviton (
talk ) 16:38, 28 January 2020 (UTC)
reply
10 -
Cerium(IV) oxide -
wikt:Cerium(IV ,
wikt:Cerium(IV ,
wikt:cerium(III ,
wikt:cerium(IV ,
wikt:cerium(IV ,
wikt:cerium(IV ,
wikt:cerium(III ,
wikt:cerium(IV ,
wikt:cerium(III : chemistry notation.
Ira Leviton (
talk ) 16:38, 28 January 2020 (UTC)
reply
8 -
Cerium(IV) oxide–cerium(III) oxide cycle -
wikt:cerium(IV ,
wikt:cerium(III ,
wikt:cerium(IV ,
wikt:cerium(III ,
wikt:cerium(IV ,
wikt:cerium(III ,
wikt:cerium(III ,
wikt:cerium(IV : chemistry notation.
Ira Leviton (
talk ) 16:38, 28 January 2020 (UTC)
reply
1 -
Cerium(IV) sulfate -
wikt:Cerium(IV : chemistry notation.
Ira Leviton (
talk ) 16:38, 28 January 2020 (UTC)
reply
1 -
Cerulean -
wikt:cobalt(II : chemistry notation.
Ira Leviton (
talk ) 16:38, 28 January 2020 (UTC)
reply
1 -
Ceruletide - Tyr[SO: part of chemistry notation.
Ira Leviton (
talk ) 16:38, 28 January 2020 (UTC)
reply
2 -
Cerussite -
wikt:Lead(II : chemistry notation.
Ira Leviton (
talk ) 16:38, 28 January 2020 (UTC)
reply
2 -
Cha-La Head-Cha-La - mobi[le, re]make - written as mobi[le-re]make version
Strickesel (
talk )
1 -
Chains (novel) -
wikt:you - "saying please and thank you"
Strickesel (
talk )
1 -
Chak 168/171 NB -
wikt:Check(points - written as Check(points)
Strickesel (
talk )
7 -
Chak 65 GB Mukandpur -
wikt:numberdar ,
wikt:zarieay ,
wikt:razay ,
wikt:hasool (probably OK:
wikt:numbardar ,
wikt:khalaq ,
wikt:alaahi ) - they're probably all okay, but the text needs a complete rewrite anyway
Strickesel (
talk )
1 -
Chakwal -
wikt:sarpak - can't find info if typo
Strickesel (
talk )
1 -
Chalcogenide glass -
wikt:Gallium(III - chemical term
Strickesel (
talk )
1 -
Chaldean Catholic Territory Dependent on the Patriarch of Jordan -
wikt:Trans)Jordan - written as (Trans)Jordan
Strickesel (
talk )
2 -
Challenge–response authentication -
wikt:hash(cc ,
wikt:hash(sc - informatics notation
Strickesel (
talk )
2 -
Chalybeate -
wikt:Iron(II ,
wikt:Manganese(II - chemical terms
Strickesel (
talk )
2 -
Chamavi -
wikt:Ch)amavorum ,
wikt:amavorum - written as (Ch)amavorum
Strickesel (
talk )
14 -
Champakesvara Siva Temple -
wikt:apidha ,
wikt:jangha ,
wikt:jangha ,
wikt:amlaka ,
wikt:jangha ,
wikt:jangha ,
wikt:udyota (probably OK:
wikt:patalaphuta ,
wikt:panchangabada ,
wikt:pabhaga ,
wikt:pabhaga ,
wikt:pabhaga ,
wikt:khapuri ,
wikt:pabhaga ) - the article is filled with non-english words that probably just weren't translated. Should be looked over, but don't know the correct tag
Strickesel (
talk )
1 -
Chantal Pontbriand - with[out - written as with[out]
Strickesel (
talk )
1 -
Chaotic Wrestling - fed[eration - written as fed[eration]
Strickesel (
talk )
8 -
Chapel of D. Fradique -
wikt:MARG(ARID ,
wikt:VIC(ENT ,
wikt:ANT(ONI ,
wikt:AN)DO ,
wikt:AGESTA)DE ,
wikt:lebrus ,
wikt:lebrus (probably OK:
wikt:caneletes ) - first five are part of a seemingly correct latin inscription, last three might be a remnant from portuguese, but couldn't find actual translations
Strickesel (
talk )
2 -
Chapelcross nuclear power station -
wikt:MW(th ,
wikt:MW(th - written as MW(th), might be correct
Strickesel (
talk )
1 -
Char siu -
wikt:cha(zi - written as cha(zi)
Strickesel (
talk )
1 -
Charlene James -
wikt:Dad(die - a play, written as Dad(die)
Strickesel (
talk )
2 -
Charles Albert III, Prince of Hohenlohe-Waldenburg-Schillingsfürst -
wikt:Prince(ss ,
wikt:Prince(ss - written as prince(ss)
Strickesel (
talk )
1 -
Charles Blackstone -
wikt:Non)Fictions - (Non)Fictions, part of a title
Strickesel (
talk )
1 -
Charles Bolden -
wikt:VMA(AW - part of a plane name
Strickesel (
talk )
1 -
Charles Boog Watson -
wikt:FSA(Scot - FSA(Scot), might be okay
Strickesel (
talk )
1 -
Charles Clews -
wikt:mis)adventures - (mis)adventures
Strickesel (
talk )
1 -
Charles Coulson -
wikt:Alex(ander - Alex(ander)
Strickesel (
talk )
1 -
Charles Dufour -
wikt:parish(es - "respective parish(es)"
Strickesel (
talk )
2 -
Charles Esche -
wikt:co)curated - (co)curated
Strickesel (
talk )
2 -
Charles Haros -
wikt:Mis)naming ,
wikt:dovient - (Mis)naming; french
Strickesel (
talk )
1 -
Charles Hunter Stewart -
wikt:FSA(Scot - FSA(scot)
Strickesel (
talk )
1 -
Charles L. Young Sr. -
wikt:Vel(dore - Vel(dore)
Strickesel (
talk )
1 -
Charles Lutz -
wikt:CON)TEXT - (CON)TEXT, the name of an exhibition
Strickesel (
talk )
3 -
Charm (programming language) - write_string[proc: software jargon.
Ira Leviton (
talk ) 21:47, 1 February 2020 (UTC)
reply
4 -
Chelation -
wikt:copper(II ,
wikt:Cu(en ,
wikt:Cu(MeNH : chemistry notation.
Ira Leviton (
talk ) 21:47, 1 February 2020 (UTC)
reply
7 -
Chemical garden -
wikt:cobalt(II ,
wikt:Copper(II ,
wikt:Chromium(III ,
wikt:Nickel(II ,
wikt:Iron(II ,
wikt:Iron(III ,
wikt:Cobalt(II : chemistry notation.
Ira Leviton (
talk ) 16:38, 28 January 2020 (UTC)
reply
6 -
Chemical oscillator -
wikt:cerium(IV ,
wikt:cerium(IV ,
wikt:cerium(III ,
wikt:cerium(IV ,
wikt:cerium(III ,
wikt:cerium(IV : chemistry notation.
Ira Leviton (
talk ) 16:38, 28 January 2020 (UTC)
reply
2 -
Chemical substance -
wikt:iron(II ,
wikt:Iron(II : chemistry notation.
Ira Leviton (
talk ) 14:46, 30 January 2020 (UTC)
reply
2 -
Chemical transport reaction -
wikt:iron(III ,
wikt:iron(III : chemistry notation.
Ira Leviton (
talk ) 14:46, 30 January 2020 (UTC)
reply
9 -
Chemical vapor deposition of ruthenium -
wikt:ruthenium(II ,
wikt:ruthenium(II ,
wikt:toluene)Ru ,
wikt:toluene)Ru ,
wikt:benzene)Ru ,
wikt:benzene)Ru ,
wikt:toluene)Ru ,
wikt:benzene)Ru : chemistry notation.
Ira Leviton (
talk ) 14:46, 30 January 2020 (UTC)
reply
2 -
Chert -
wikt:iron(III ,
wikt:eraillures : chemical notation and a plural geological term.
Ira Leviton (
talk ) 05:25, 2 February 2020 (UTC)
reply
1 -
Chester Smith - Real]Music: [Real]Music is the name of an album.
Ira Leviton (
talk ) 05:25, 2 February 2020 (UTC)
reply
1 -
Chevreul's salt -
wikt:copper(II : chemical notation.
Ira Leviton (
talk ) 05:25, 2 February 2020 (UTC)
reply
2 -
Chi-Ming Che -
wikt:gold(III : chemical notation.
4 -
Chichester inscription - DO[MVS, CO]GIDVBNI, MA]GNI, COLE]GIVM: as in an inscription.
Ira Leviton (
talk ) 01:39, 4 February 2020 (UTC)
reply
3 -
Chichibabin pyridine synthesis -
wikt:aluminium(III : chemical notation.
Ira Leviton (
talk ) 01:39, 4 February 2020 (UTC)
reply
1 -
Chief Commission for the Prosecution of Crimes against the Polish Nation -
wikt:Research(ing : looks like this is deliberate.
Ira Leviton (
talk ) 01:39, 4 February 2020 (UTC)
reply
1 -
Chien-Shiung Wu -
wikt:copper(II : chemistry notation.
Ira Leviton (
talk ) 01:39, 4 February 2020 (UTC)
reply
2 -
Child custody laws in the United States -
wikt:child(ren ,
wikt:child(ren : written this way to indicate both singular and plural.
Ira Leviton (
talk ) 16:59, 3 February 2020 (UTC)
reply
4 -
Child support -
wikt:child(ren ,
wikt:child(ren ,
wikt:child(ren ,
wikt:child(ren : written this way to indicate both singular and plural.
Ira Leviton (
talk ) 16:59, 3 February 2020 (UTC)
reply
1 -
Children's Island Sanitarium -
wikt:demand(ed : in a quotation.
Ira Leviton (
talk ) 16:59, 3 February 2020 (UTC)
reply
1 -
Children's Rights Council -
wikt:child(ren : written this way to indicate both singular and plural.
Ira Leviton (
talk ) 16:59, 3 February 2020 (UTC)
reply
3 -
Chilean Communist Party (Proletarian Action) -
wikt:PC(AP ,
wikt:PC(AP ,
wikt:PC(AP : an abbreviation.
Ira Leviton (
talk ) 16:59, 3 February 2020 (UTC)
reply
Chindon'ya -
wikt:hatadori is OK, similar to: (probably OK:
wikt:hyogoshi ,
wikt:hikifuda ,
wikt:hatamochi etc.)
Chinese History: A New Manual -
wikt:ecofactual - ecofactual materials (food/midden remains, soil samples, and vegetal material)
Chiral Lewis acid - (not OK:
wikt:dihydroxythioester , should be dihydroxy thioester )
Chirnside -
wikt:church(es - context is: church or churches
Chirosathi -
wikt:chatterjee_(durgapur_kuldiha - removed from article, appears to be vandalism
Chittamuru Ramaiah -
wikt:Madaras(Chennai - added space, noting Madras misspelled as Madaras, updated.
Chittor Fort -
wikt:jauhars ,
wikt:jauhars - article:
Jauhar
Chloro(cyclopentadienyl)bis(triphenylphosphine)ruthenium -
wikt:RuCl(PPh ,
wikt:ruthenium(II ,
wikt:RuCl(PPh ,
wikt:ruthenium(III ,
wikt:ruthenium(II ,
wikt:tris(acetonitrile ,
wikt:ruthenium(II - chemistry spacing
Chloro(dimethyl sulfide)gold(I) -
wikt:sulfide)gold ,
wikt:sulfide)gold ,
wikt:gold(III ,
wikt:sulfide)gold - chemistry spacing
Chloro(tetrahydrothiophene)gold(I) -
wikt:Chloro(tetrahydrothiophene ,
wikt:tht)AuCl - chemistry spacing
4 -
Chloro(triphenylphosphine)gold(I) -
wikt:sulfide)gold : chemistry notation.
Ira Leviton (
talk ) 16:59, 3 February 2020 (UTC)
reply
5 -
Chloroauric acid -
wikt:Au(bipy ,
wikt:gold(III ,
wikt:gold(III : chemistry notation.
Ira Leviton (
talk ) 16:59, 3 February 2020 (UTC)
reply
1 -
Chlorobis(ethylene)rhodium dimer -
wikt:Rh(acac : chemistry notation.
Ira Leviton (
talk ) 16:59, 3 February 2020 (UTC)
reply
1 -
Chlorogenate—glucarate O-hydroxycinnamoyltransferase -
wikt:hydroxycinnamoyl)transferase : part of the name of an enzyme.
Ira Leviton (
talk ) 16:59, 3 February 2020 (UTC)
reply
5 -
Chloropentamminecobalt chloride - Cl]Cl,
wikt:chloropentaamminecobalt(III ,
wikt:chloropentaamminecobalt(III , Cl]Cl: chemistry notation.
Ira Leviton (
talk ) 16:59, 3 February 2020 (UTC)
reply
1 -
Chlorophyll(ide) b reductase -
wikt:Chlorophyll(ide : chemistry notation.
Ira Leviton (
talk ) 16:59, 3 February 2020 (UTC)
reply
1 -
Chloroplatinic acid -
wikt:platinum(IV : chemistry notation.
Ira Leviton (
talk ) 16:59, 3 February 2020 (UTC)
reply
1 -
Choline transporter -
wikt:tm1a(KOMP : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
18 -
Chordioid -
wikt:Rawlins(2005 ,
wikt:chordioids ,
wikt:chordioids ,
wikt:chordioids ,
wikt:chordioids ,
wikt:chordioids ,
wikt:chordioids ,
wikt:chordioids ,
wikt:chordioids ,
wikt:chordioids ,
wikt:chordioids ,
wikt:chordioids ,
wikt:chordioids ,
wikt:chordiods ,
wikt:chordioids ,
wikt:chordioids ,
wikt:chordioids ,
wikt:chordioids ,
wikt:chordioids : plural of the subject of the page.
Ira Leviton (
talk ) 00:21, 2 February 2020 (UTC)
reply
1 -
Chrau language -
wikt:Chrau(also ,
wikt:presyllables : seems like a legitimate linguistic term.
Ira Leviton (
talk ) 00:21, 2 February 2020 (UTC)
reply
3 -
Chris Slight - indie[dot, indie[dot, indie[dot: part of a title.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
1 -
Christian Brassington -
wikt:Five(ish : part of a title.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
1 -
Christian Hebraist -
wikt:Paul(us : correct.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
2 -
Christian Thomsen Carl -
wikt:Carl(son ,
wikt:Carl(son : written deliberately as "Carl(son)" because both names were used.
1 -
Christine Harrison -
wikt:rob(15 : genetics terminology.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
2 -
Christine S. Chow -
wikt:platinum(II : chemistry notation.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
1 -
Christoph Ernst Friedrich Weyse -
wikt:Christoph(er : written deliberately as "Christoph(er)".
1 -
Christopher Paudiß -
wikt:Christoph(er : written deliberately as "Christop(er)".
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
1 -
Christophor Vermishyan -
wikt:Vermishyan(ts : written deliberately as "Vermishyan(ts)" to show pronunciation.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
5 -
Chromate and dichromate -
wikt:Chromium(VI ,
wikt:chromium(VI ,
wikt:chromium(III ,
wikt:iron(III : chemistry notation.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
2 -
Chromate conversion coating -
wikt:chromium(IV ,
wikt:iridite : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
2 -
Chromate ester -
wikt:chromium(VI ,
wikt:chromium(IV : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
2 -
Chromated copper arsenate -
wikt:copper(II ,
wikt:copper(II : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
3 -
Chrome alum -
wikt:Chromium(III ,
wikt:chromium(III ,
wikt:chromium(III : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
1 -
Chrome chalcedony -
wikt:chromium(III : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
1 -
Chrome orange -
wikt:lead(II : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
1 -
Chrome yellow -
wikt:lead(II : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
2 -
Chromium acetate -
wikt:Chromium(II ,
wikt:Chromium(III : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
3 -
Chromium chloride -
wikt:Chromium(II ,
wikt:Chromium(III ,
wikt:Chromium(IV : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
4 -
Chromium fluoride -
wikt:Chromium(II ,
wikt:Chromium(III ,
wikt:Chromium(IV ,
wikt:Chromium(VI : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
1 -
Chromium hexacarbonyl -
wikt:CpCr(CO : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
1 -
Chromium hexafluoride -
wikt:chromium(VI : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
2 -
Chromium nitride -
wikt:chromium(III ,
wikt:Chromium(III : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
6 -
Chromium oxide -
wikt:Chromium(II ,
wikt:Chromium(III ,
wikt:chromium(IV ,
wikt:chromium(III ,
wikt:chromium(VI ,
wikt:Chromium(VI : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
2 -
Chromium pentafluoride -
wikt:chromium(III ,
wikt:chromium(VI : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
2 -
Chromium sulfate -
wikt:Chromium(II ,
wikt:Chromium(III : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
15 -
Chromium toxicity -
wikt:chromium(III ,
wikt:chromium(VI ,
wikt:chromium(VI ,
wikt:chromium(VI ,
wikt:chromium(VI ,
wikt:chromium(III ,
wikt:chromium(III ,
wikt:Chromium(IV ,
wikt:chromium(III ,
wikt:chromium(III ,
wikt:chromium(III ,
wikt:chromium(III ,
wikt:Chromium(III ,
wikt:chromium(III : ditto
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
6 -
Chromium trifluoride -
wikt:Chromium(III ,
wikt:chromium(III ,
wikt:Chromium(III ,
wikt:chromium(III ,
wikt:Chromium(III ,
wikt:Chromium(III : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
7 -
Chromium(II) acetate -
wikt:Chromium(II ,
wikt:chromium(II ,
wikt:copper(II ,
wikt:chromium(II ,
wikt:chromium(II ,
wikt:chromium(II ,
wikt:Chromium(II : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
2 -
Chromium(II) acetylacetonate -
wikt:Chromium(II ,
wikt:chromium(II : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
1 -
Chromium(II) bromide -
wikt:Chromium(II : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
5 -
Chromium(II) chloride -
wikt:Chromium(II ,
wikt:Chromium(II ,
wikt:chromium(III ,
wikt:chromium(II ,
wikt:Chromium(II : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
5 -
Chromium(II) fluoride -
wikt:Chromium(II ,
wikt:Chromium(II ,
wikt:chromium(II ,
wikt:chromium(III ,
wikt:chromium(II : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
1 -
Chromium(II) oxalate -
wikt:Chromium(II : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
3 -
Chromium(II) oxide -
wikt:Chromium(II ,
wikt:chromium(III ,
wikt:chromium(II : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
1 -
Chromium(II) selenide -
wikt:Chromium(II : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
1 -
Chromium(II) silicide -
wikt:Chromium(II : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
6 -
Chromium(II) sulfate -
wikt:Chromium(II ,
wikt:chromium(II ,
wikt:chromium(II ,
wikt:chromium(III ,
wikt:chromium(II ,
wikt:copper(II : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
1 -
Chromium(III) 2-ethylhexanoate -
wikt:Chromium(III : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
3 -
Chromium(III) acetate -
wikt:Chromium(III ,
wikt:chromium(III ,
wikt:Chromium(III : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
5 -
Chromium(III) acetylacetonate -
wikt:Chromium(III ,
wikt:Cr(acac ,
wikt:chromium(III ,
wikt:Cr(acac : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
2 -
Chromium(III) boride -
wikt:Chromium(III ,
wikt:monoboride : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
2 -
Chromium(III) bromide -
wikt:Chromium(III ,
wikt:chromium(III : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
1 -
Chromium(III) hydroxide -
wikt:Chromium(III : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
4 -
Chromium(III) iodide -
wikt:Chromium(III ,
wikt:chromium(III ,
wikt:chromium(II : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
3 -
Chromium(III) nicotinate -
wikt:Chromium(III ,
wikt:Chromium(III ,
wikt:chromium(III : ditto.
3 -
Chromium(III) nitrate -
wikt:Chromium(III ,
wikt:Chromium(III ,
wikt:chromium(III : ditto.
5 -
Chromium(III) oxide -
wikt:Chromium(III ,
wikt:Chromium(III ,
wikt:Chromium(III ,
wikt:chromium(III ,
wikt:chromium(III : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
13 -
Chromium(III) sulfate -
wikt:Chromium(III ,
wikt:Chromium(III ,
wikt:chromium(III ,
wikt:chromium(III ,
wikt:chromium(II ,
wikt:chromium(III ,
wikt:chromium(III ,
wikt:chromium(VI ,
wikt:chromium(III ,
wikt:chromium(III ,
wikt:chromium(III ,
wikt:chromium(III ,
wikt:chromium(III : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
3 -
Chromium(III) sulfide -
wikt:Chromium(III ,
wikt:Chromium(III : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
1 -
Chromium(III) telluride -
wikt:chromium(III : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
2 -
Chromium(IV) chloride -
wikt:Chromium(IV ,
wikt:chromium(III : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
1 -
Chromium(IV) fluoride -
wikt:Chromium(IV : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
3 -
Chromium(IV) oxide -
wikt:chromium(IV ,
wikt:chromium(IV : ditto.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
1 -
Chromo shadow domain -
wikt:Su(var : part of a protein name.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
5 -
Chromocene -
wikt:chromium(II ,
wikt:chromium(III ,
wikt:chromium(II ,
wikt:chromium(II : chemical notation.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
1 -
Chromoprotein -
wikt:anthrozoa : a legit word.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
2 -
Chromosome -
wikt:idic(15 : molecular biology jargon.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
1 -
Chromosome 1 open reading frame 194 -
wikt:poly(rC : molecular biology jargon.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
1 -
Chromosome instability -
wikt:poly(ADP : molecular biology jargon.
Ira Leviton (
talk ) 23:06, 25 January 2020 (UTC)
reply
1 -
Chu Lai Air Base -
wikt:VMA(AW : part of a military abbreviation.
Ira Leviton (
talk ) 18:00, 4 February 2020 (UTC)
reply
3 -
Chuck Jones filmography -
wikt:24½th ,
wikt:24½th : parts of movie titles.
Ira Leviton (
talk ) 18:00, 4 February 2020 (UTC)
reply
1 -
Chuping -
wikt:iron(III : chemistry notation.
Ira Leviton (
talk ) 18:00, 4 February 2020 (UTC)
reply
1 -
Churning (cipher) -
wikt:TransformNibble(Y5 : software coding.
Ira Leviton (
talk ) 18:00, 4 February 2020 (UTC)
reply
1 -
Ciliary neurotrophic factor receptor -
wikt:tm1a(EUCOMM : molecular biology notation.
Ira Leviton (
talk ) 23:26, 26 January 2020 (UTC)
reply
5 -
Cinnabar -
wikt:mercury(II ,
wikt:gallium(III ,
wikt:mercury(II ,
wikt:mercury(II ,
wikt:mercury(II : chemical notation.
Ira Leviton (
talk ) 22:14, 4 February 2020 (UTC)
reply
1 -
Cinnabar (disambiguation) -
wikt:mercury(II : chemical notation.
Ira Leviton (
talk ) 22:14, 4 February 2020 (UTC)
reply
2 -
Circe chess -
wikt:Rxe8(Ng8 ,
wikt:wBf1(hidden : chess notation.
Ira Leviton (
talk ) 22:14, 4 February 2020 (UTC)
reply
1 -
Circle packing -
wikt:Sqrt(12 : mathematical notation for square root. It probably should be in math font, which I don't know how to do well.
Ira Leviton (
talk ) 22:14, 4 February 2020 (UTC)
reply
2 -
Circular ensemble -
wikt:Sp(2n ,
wikt:Sp(2m : mathematical notation. It probably should be in math font, which I don't know how to do well.
Ira Leviton (
talk ) 22:14, 4 February 2020 (UTC)
reply
1 -
Cis-Dichlorobis(bipyridine)ruthenium(II) -
wikt:ruthenium(II : chemistry notation.
Ira Leviton (
talk ) 19:28, 4 February 2020 (UTC)
reply
1 -
Cisplatin -
wikt:PtCl(guanine : chemistry notation.
Ira Leviton (
talk ) 19:28, 4 February 2020 (UTC)
reply
1 -
Citizen suit - trace[able: paraphrasing a quotation.
Ira Leviton (
talk ) 19:28, 4 February 2020 (UTC)
reply
2 -
Claire Wong -
wikt:wo(men - = wo(men) - intentional
Ingratis (
talk ) 01:36, 31 January 2020 (UTC)
reply
3 -
Clan Analogue -
wikt:if)tek ,
wikt:if)tek ,
wikt:if)tek = B(if)tek - proper name
Ingratis (
talk ) 01:36, 31 January 2020 (UTC)
reply
1 -
Clara Ng -
wikt:Un)Reality - = "(Un)Reality" - literary title
Ingratis (
talk ) 01:36, 31 January 2020 (UTC)
reply
1 -
Clarrie O'Shea -
wikt:CPA(ML - ok
Ingratis (
talk ) 01:36, 31 January 2020 (UTC)
reply
4 -
Classical guitar with additional strings - BD]EADGBE = [BD]EADGBE - guitar string sequence
Ingratis (
talk ) 01:36, 31 January 2020 (UTC)
reply
7 -
Clathrochelate -
wikt:tris(dioximate ,
wikt:cobalt(III ,
wikt:iron(II ,
wikt:cobalt(III = tris(dioximate), cobalt(III), iron(II), cobalt(III) - all OK chemical terms
Ingratis (
talk ) 01:36, 31 January 2020 (UTC)
reply
4 -
Claudius Hieronymianus -
wikt:CL(audius ,
wikt:LEG(atus ,
wikt:LEG(ionis ,
wikt:VIC(tricis - expansions of abbreviations from Latin inscription
Ingratis (
talk ) 01:36, 31 January 2020 (UTC)
reply
2 -
Claus process -
wikt:aluminum(III ,
wikt:titanium(IV = aluminum(III), titanium(IV) - correct chemical terms
Ingratis (
talk ) 01:36, 31 January 2020 (UTC)
reply
1 -
Claw-free graph -
wikt:srg(27 = srg(27,16,10,8) - correct expression of graph parameters
Ingratis (
talk ) 01:36, 31 January 2020 (UTC)
reply
1 -
Clinozoisite -
wikt:iron(III =iron(III) - correct chemical term
Ingratis (
talk ) 13:01, 31 January 2020 (UTC)
reply
5 -
Clipper architecture -
wikt:d12(Rn ,
wikt:d32(Rn ,
wikt:d16(PC ,
wikt:d32(PC (probably OK:
wikt:predecrement ) - all OK except "pre decrement", which seems normally to be written as two words
Ingratis (
talk ) 13:01, 31 January 2020 (UTC)
reply
2 -
Clonkeen College - Ho[use = "Ho[use]"
Ingratis (
talk ) 00:00, 4 February 2020 (UTC)
reply
1 -
Clueless (House) -
wikt:Tin(II = "Tin(II) - OK chemical term
Ingratis (
talk ) 00:00, 4 February 2020 (UTC)
reply
1 -
Cnidoscolus stimulosus -
wikt:stimul(us = mistaken break
Ingratis (
talk ) 00:00, 4 February 2020 (UTC)
reply
4 -
Cob(II)alamin reductase -
wikt:cob(II ,
wikt:cob(II ,
wikt:cob(II ,
wikt:cob(II : chemical notation.
Ira Leviton (
talk ) 16:11, 4 February 2020 (UTC)
reply
4 -
Cob(II)yrinic acid a,c-diamide reductase -
wikt:cob(II ,
wikt:cob(II ,
wikt:cob(II ,
wikt:cob(II : chemical notation.
Ira Leviton (
talk ) 16:11, 4 February 2020 (UTC)
reply
1 -
Cobalt boride -
wikt:Cobalt(II : chemical notation.
Ira Leviton (
talk ) 16:11, 4 February 2020 (UTC)
reply
2 -
Cobalt chelatase -
wikt:cob(II ,
wikt:cob(II : chemical notation.
Ira Leviton (
talk ) 16:11, 4 February 2020 (UTC)
reply
2 -
Cobalt chloride -
wikt:Cobalt(II ,
wikt:Cobalt(III : chemical notation.
Ira Leviton (
talk ) 16:11, 4 February 2020 (UTC)
reply
2 -
Cobalt fluoride -
wikt:Cobalt(II ,
wikt:Cobalt(III : chemical notation.
Ira Leviton (
talk ) 16:11, 4 February 2020 (UTC)
reply
3 -
Cobalt green -
wikt:cobalt(II ,
wikt:cobalt(II ,
wikt:chromium(III : chemical notation.
Ira Leviton (
talk ) 16:11, 4 February 2020 (UTC)
reply
3 -
Cobalt oxide -
wikt:Cobalt(II ,
wikt:Cobalt(III ,
wikt:Cobalt(II : chemical notation.
Ira Leviton (
talk ) 16:11, 4 February 2020 (UTC)
reply
1 -
Cobalt phosphate -
wikt:cobalt(II : chemical notation.
Ira Leviton (
talk ) 16:11, 4 February 2020 (UTC)
reply
1 -
Cobalt sulfide -
wikt:cobalt(II : chemical notation.
Ira Leviton (
talk ) 16:11, 4 February 2020 (UTC)
reply
5 -
Cobalt(II) acetate -
wikt:Cobalt(II ,
wikt:Cobalt(II ,
wikt:Co(salen : chemical notation.
Ira Leviton (
talk ) 16:11, 4 February 2020 (UTC)
reply
11 -
Cobalt(II) bromide -
wikt:Cobalt(II ,
wikt:cobalt(II ,
wikt:cobalt(II ,
wikt:cobalt(II ,
wikt:Cobalt(II ,
wikt:cobalt(II ,
wikt:bromopentaamminecobalt(III ,
wikt:cobalt(II , Br]Br,
wikt:cobalt(II ,
wikt:cobalt(II : chemical notation.
Ira Leviton (
talk ) 16:11, 4 February 2020 (UTC)
reply
2 -
Cobalt(II) carbonate -
wikt:Cobalt(II ,
wikt:Cobalt(II : chemical notation.
Ira Leviton (
talk ) 16:11, 4 February 2020 (UTC)
reply
3 -
Cobalt(II) chlorate -
wikt:Cobalt(II ,
wikt:cobalt(II : chemical notation.
Ira Leviton (
talk ) 16:11, 4 February 2020 (UTC)
reply
2 -
Cobalt(II) cyanide -
wikt:Cobalt(II ,
wikt:Cobalt(II : chemical notation.
Ira Leviton (
talk ) 16:11, 4 February 2020 (UTC)
reply
10 -
Cobalt(II) fluoride -
wikt:Cobalt(II ,
wikt:Cobalt(II ,
wikt:cobalt(II ,
wikt:cobalt(II ,
wikt:cobalt(II ,
wikt:cobalt(II ,
wikt:Cobalt(II ,
wikt:Cobalt(II ,
wikt:Cobalt(II ,
wikt:Cobalt(II : chemical notation.
Ira Leviton (
talk ) 16:11, 4 February 2020 (UTC)
reply
1 -
Cobalt(II) formate -
wikt:Cobalt(II : chemical notation.
Ira Leviton (
talk ) 16:11, 4 February 2020 (UTC)
reply
13 -
Cobalt(II) hydroxide -
wikt:Cobalt(II ,
wikt:Cobalt(II ,
wikt:Cobalt(II ,
wikt:cobalt(II ,
wikt:Cobalt(II ,
wikt:cobalt(II ,
wikt:iron(II ,
wikt:cobalt(II ,
wikt:cobalt(II ,
wikt:cobaltate(II ,
wikt:cobalt(II ,
wikt:cobalt(II ,
wikt:cobalt(II : chemical notation.
Ira Leviton (
talk ) 16:11, 4 February 2020 (UTC)
reply
6 -
Cobalt(II) iodide -
wikt:Cobalt(II ,
wikt:Cobalt(II ,
wikt:cobalt(II ,
wikt:Cobalt(II ,
wikt:cobalt(II ,
wikt:Cobalt(II : chemical notation.
Ira Leviton (
talk ) 16:11, 4 February 2020 (UTC)
reply
6 -
Cobalt(II) nitrate -
wikt:cobalt(II ,
wikt:cobalt(II ,
wikt:cobalt(II ,
wikt:cobalt(II ,
wikt:hexaaquacobalt(II : chemical notation.
Ira Leviton (
talk ) 16:11, 4 February 2020 (UTC)
reply
1 -
Cobalt(II) oxalate -
wikt:Cobalt(II : chemical notation.
Ira Leviton (
talk ) 16:11, 4 February 2020 (UTC)
reply
8 -
Cobalt(II) oxide -
wikt:Cobalt(II ,
wikt:cobalt(II ,
wikt:Cobalt(II ,
wikt:cobalt(II ,
wikt:cobalt(II ,
wikt:cobalt(II ,
wikt:cobalt(II ,
wikt:Cobalt(II : chemical notation.
Ira Leviton (
talk ) 16:11, 4 February 2020 (UTC)
reply
1 -
Cobalt(II) phosphide -
wikt:Cobalt(II : chemical notation.
Ira Leviton (
talk ) 16:11, 4 February 2020 (UTC)
reply
1 -
Cobalt(II) selenide -
wikt:Cobalt(II : chemical notation.
Ira Leviton (
talk ) 16:11, 4 February 2020 (UTC)
reply
4 -
Cobalt(II) sulfate -
wikt:Cobalt(II ,
wikt:Cobalt(II ,
wikt:cobalt(II ,
wikt:Cobalt(II : chemical notation.
Ira Leviton (
talk ) 16:11, 4 February 2020 (UTC)
reply
5 -
Cobalt(II,III) oxide -
wikt:Cobalt(II ,
wikt:Cobalt(II ,
wikt:Cobalt(II ,
wikt:cobalt(II ,
wikt:Cobalt(II : chemical notation.
Ira Leviton (
talk ) 16:11, 4 February 2020 (UTC)
reply
14 -
Cobalt(III) chloride -
wikt:Cobalt(III ,
wikt:cobalt(II ,
wikt:hexachlorocobaltate(III ,
wikt:cobalt(II ,
wikt:cobalt(III ,
wikt:cobalt(II ,
wikt:hexachlorocobaltate(III ,
wikt:cobalt(III ,
wikt:cobalt(III ,
wikt:cobalt(III ,
wikt:hexamminecobalt(III ,
wikt:cobalt(III : chemical notation.
Ira Leviton (
talk ) 16:11, 4 February 2020 (UTC)
reply
5 -
Cobalt(III) fluoride -
wikt:Cobalt(III ,
wikt:Cobalt(II ,
wikt:cobalt(II ,
wikt:cobalt(III ,
wikt:cobalt(III : chemical notation.
Ira Leviton (
talk ) 16:11, 4 February 2020 (UTC)
reply
4 -
Cobalt(III) hydroxide -
wikt:Cobalt(III ,
wikt:cobalt(II ,
wikt:cobalt(II ,
wikt:cobalt(II : chemical notation.
Ira Leviton (
talk ) 16:11, 4 February 2020 (UTC)
reply
7 -
Cobalt(III) nitrate -
wikt:Cobalt(III ,
wikt:Cobalt(III ,
wikt:Cobalt(III ,
wikt:cobalt(III ,
wikt:Cobalt(III ,
wikt:cobalt(II ,
wikt:Cobalt(III : chemical notation.
Ira Leviton (
talk ) 16:11, 4 February 2020 (UTC)
reply
3 -
Cobaltocene -
wikt:cobalt(II ,
wikt:cobalt(II : chemical notation.
Ira Leviton (
talk ) 16:11, 4 February 2020 (UTC)
reply
1 -
Coccinite -
wikt:mercury(II : chemical notation.
Ira Leviton (
talk ) 16:11, 4 February 2020 (UTC)
reply
1 -
Coco3 -
wikt:Cobalt(II : chemical notation.
Ira Leviton (
talk ) 16:11, 4 February 2020 (UTC)
reply
1 -
Colin Baker -
wikt:Five(ish - part of a title
Strickesel (
talk )
12 -
Collagen, type II, alpha 1 -
wikt:alpha1(II ,
wikt:alpha1(II ,
wikt:alpha1(II ,
wikt:alpha1(II ,
wikt:alpha1(II ,
wikt:alpha1(II ,
wikt:alpha1(II ,
wikt:alpha1(II ,
wikt:alpha1(II ,
wikt:alpha1(II ,
wikt:alpha1(II ,
wikt:alpha1(II : chemistry notation.
Ira Leviton (
talk ) 20:25, 4 February 2020 (UTC)
reply
6 -
Collagen, type VI, alpha 1 -
wikt:alpha1(VI ,
wikt:alpha2(VI ,
wikt:alpha3(VI ,
wikt:alpha2(VI ,
wikt:alpha3(VI ,
wikt:alpha1(VI : chemistry notation.
Ira Leviton (
talk ) 20:25, 4 February 2020 (UTC)
reply
9 -
Collagen, type XI, alpha 2 -
wikt:alpha2(XI ,
wikt:alpha2(XI ,
wikt:alpha1(XI ,
wikt:alpha1(II ,
wikt:alpha2(XI ,
wikt:alpha2(XI ,
wikt:alpha2(XI ,
wikt:alpha2(XI ,
wikt:alpha2(XI : chemistry notation.
Ira Leviton (
talk ) 20:25, 4 February 2020 (UTC)
reply
1 -
Collagen, type XVII, alpha 1 -
wikt:alpha1(XVII : chemistry notation.
Ira Leviton (
talk ) 20:25, 4 February 2020 (UTC)
reply
10 -
Collagen, type XXIII, alpha 1 -
wikt:α1(XXIII ,
wikt:α1(XIII ,
wikt:α1(XXIII ,
wikt:α1(XXV ,
wikt:α1(XXIII ,
wikt:α1(XIII ,
wikt:α1(XXV ,
wikt:α1(XXIII ,
wikt:α1(XIII ,
wikt:α1(XXV : chemistry notation.
Ira Leviton (
talk ) 20:25, 4 February 2020 (UTC)
reply
1 -
Collins oxidation -
wikt:chromium(VI : chemistry notation.
Ira Leviton (
talk ) 20:25, 4 February 2020 (UTC)
reply
1 -
Collins reagent -
wikt:chromium(VI : chemistry notation.
Ira Leviton (
talk ) 20:25, 4 February 2020 (UTC)
reply
8 -
Collision attack -
wikt:hash(m1 ,
wikt:hash(m2 ,
wikt:hash(p1 ,
wikt:hash(p2 ,
wikt:hash(m1 ,
wikt:hash(m2 ,
wikt:hash(p1 ,
wikt:hash(p2 : software jargon.
Ira Leviton (
talk ) 20:25, 4 February 2020 (UTC)
reply
2 -
Colneleate synthase -
wikt:yloxy)non , yloxy]non: parts of chemical names.
Ira Leviton (
talk ) 20:25, 4 February 2020 (UTC)
reply
1 -
Color appearance model -
wikt:HPE(D65 - seems to be correct
Strickesel (
talk )
1 -
Color of chemicals -
wikt:vanadium(III - chemical notation
Strickesel (
talk )
1 -
Colored gold -
wikt:chromium(III - chemical notation
Strickesel (
talk )
3 -
Colossally abundant number -
wikt:nlog(log - mathematical notation
Strickesel (
talk )
1 -
Colton High School (California) -
wikt:USATF(United
1 -
Colubridae -
wikt:sub)families - seems correct
Strickesel (
talk )
1 -
Combating Terrorism Center -
wikt:Mis)Adventures - seems to be part of a title
Strickesel (
talk )
1 -
Combination machine -
wikt:Euro(pean - seems to be part of the name
Strickesel (
talk )
1 -
Combustion analysis -
wikt:Copper(II - chemical notation
Strickesel (
talk )
1 -
Come What May -
wikt:What(ever - part of a title
Strickesel (
talk )
1 -
Cometabolism -
wikt:cometabolising - the verb to this article
Strickesel (
talk )
1 -
Commission on Genetic Resources for Food and Agriculture - deal[ing - in a quote
Strickesel (
talk )
1 -
Commitment (Michael Wong album) -
wikt:you - in a song title
Strickesel (
talk )
1 -
Common operator notation -
wikt:sin(2x - mathematical notation
Strickesel (
talk )
1 -
Communist Control Act of 1954 - constitut[ed - in a quote
Strickesel (
talk )
5 -
Communist Party of Estonia (1990) -
wikt:platvormil ,
wikt:platvormil ,
wikt:platvormil ,
wikt:platvormil ,
wikt:platvormil - seems to be an estonian word
Strickesel (
talk )
1 -
Communist Party of India (Marxist–Leninist) Janashakti -
wikt:dalams - an indian word
Strickesel (
talk )
1 -
Communist Party of India (Marxist–Leninist) Liberation -
wikt:dalams - an indian word
Strickesel (
talk )
2 -
Communist Party of the Philippines -
wikt:re)creation ,
wikt:reaffirmist - both seem correct
Strickesel (
talk )
1 -
Community of practice -
wikt:re)negotiated - correct
Strickesel (
talk )
1 -
Commutator -
wikt:log(exp - mathematical notation
Strickesel (
talk )
1 -
Comparative cultural studies -
wikt:process(es - correct
Strickesel (
talk )
1 -
Compare the Meerkat -
wikt:Meer(kat - correct
Strickesel (
talk )
11 -
Comparison of Internet forum software -
wikt:sub)forums : (sub)forums.
Strickesel (
talk )
1 -
Comparison of reference management software -
wikt:re)formatting - correct
Strickesel (
talk )
1 -
Comparison of vector graphics editors -
wikt:ipelets - a real word, I think
Strickesel (
talk )
1 -
Compendium of postage stamp issuers (Sc–Sl) -
wikt:salungs - name of a currency
Strickesel (
talk )
1 -
Complete category -
wikt:pre)abelian - correct
Strickesel (
talk )
1 -
Complex metal hydride -
wikt:MgBr(THF - chemical notation
Strickesel (
talk )
1 -
Complex multiplication -
wikt:sub)ring - correct
Strickesel (
talk )
4 -
Compounds of palladium(III) -
wikt:palladium(III ,
wikt:Palladium(III ,
wikt:Pd(ttcn ,
wikt:dipalladium(III - chemical notations
Strickesel (
talk )
1 -
Computational methods for free surface flow -
wikt:div(cv - mathematical notation
Strickesel (
talk )
2 -
Computer widow -
wikt:widow(er ,
wikt:widow(er - correct
Strickesel (
talk )
2 -
Concheros string instruments -
wikt:Meca(tl ,
wikt:Huehue(tl - both correct
Strickesel (
talk )
1 -
Concrete/Rage -
wikt:Un)natural - correct
Strickesel (
talk )
1 -
Concussions in American football -
wikt:ethylidene)malononitrile - chemical notation
Strickesel (
talk )
2 -
Condatis - Con[dati,
wikt:aberau - first latin abbreviation, second probably okay
Strickesel (
talk )
1 -
Condenser (optics) -
wikt:lens(es - correct
Strickesel (
talk )
4 -
Conductive polymer -
wikt:co)polymerization ,
wikt:co)polymerization ,
wikt:co)polymerization ,
wikt:co)polymerization - all correct
Strickesel (
talk )
1 -
Confession of 1967 -
wikt:PC(USA - seems correct
Strickesel (
talk )
1 -
Conformastatic spacetimes -
wikt:Eqs(14 - correct
Strickesel (
talk )
3 -
Congener (chemistry) -
wikt:titanium(II ,
wikt:titanium(III ,
wikt:titanium(IV - chemical notation
Strickesel (
talk )
1 -
Congo red -
wikt:diyl)bis - chemical notation
Strickesel (
talk )
2 -
Conjugal Rites -
wikt:Gen(evieve ,
wikt:evieve - Gen(evieve)
Strickesel (
talk )
3 -
Conjugated microporous polymer -
wikt:Ni(cod ,
wikt:alkynl ,
wikt:ionothermal - all part of chemical names
Strickesel (
talk )
4 -
Conjunctive query -
wikt:attends(student ,
wikt:gender(student ,
wikt:gender(student2 ,
wikt:lives(student - computer science notation
Strickesel (
talk )
1 -
Conseil scolaire Viamonde -
wikt:conseillers(ères - correct, I think
Strickesel (
talk )
1 -
Conseil scolaire de district du Grand Nord de l'Ontario -
wikt:conseillers(ères - correct, I think
Strickesel (
talk )
1 -
Conseil scolaire de district du Nord-Est de l'Ontario -
wikt:conseillers(ères - correct, I think
Strickesel (
talk )
4 -
Conservation and restoration of frescos -
wikt:iron(III ,
wikt:iron(III ,
wikt:lead(II ,
wikt:amphorous - chemical notations and real words, I think
Strickesel (
talk )
1 -
Consolas -
wikt:Luc(as - correct
Strickesel (
talk )
4 -
Constant spectrum melody -
wikt:sin(2π ,
wikt:sin(2π ,
wikt:sin(2πft ,
wikt:cos(2πεt - mathematical notations
Strickesel (
talk )
3 -
Constantin Mille - Gh[eorghe,
wikt:eorghe ,
wikt:partidului - first is written as Gh[eorghe], last is part of a title
Strickesel (
talk )
1 -
Consumed scrubfowl -
wikt:BM(NH : "(specimen
BM(NH) 1988.4.3)" so I'm guessing this is the classification for it at that museum .
1 -
Consumer Culture -
wikt:work(er - correct
Strickesel (
talk )
1 -
Contact (law) -
wikt:child(ren - correct
Strickesel (
talk )
3 -
Continent pass -
wikt:air)pass ,
wikt:air)pass ,
wikt:air)pass - correct
Strickesel (
talk )
1 -
Continuing Anglican movement -
wikt:parish(es - correct
Strickesel (
talk )
1 -
Continuously variable slope delta modulation -
wikt:re)synchronization - correct
Strickesel (
talk )
2 -
Control(human, data, sound) -
wikt:control(human ,
wikt:control(human - the title of the performance
Strickesel (
talk )
3 -
Convallatoxin - yl]oxy,
wikt:mannopyranosyl)oxy ,
wikt:enolide - part of a chemical notation
Strickesel (
talk )
1 -
Convention on preventing and combating violence against women and domestic violence -
wikt:Rec(2002 - the name of a recommendation
Strickesel (
talk )
1 -
Conversation theory -
wikt:Ap(Con - a mathematical (I think) notation
Strickesel (
talk )
1 -
Conway Stewart -
wikt:'round - don't know how this is wrong
Strickesel (
talk )
2 -
Coolpad - Fab[ulous,
wikt:ulous - changed to Fab(ulous)
Strickesel (
talk )
2 -
Coordination number -
wikt:cobalt(II ,
wikt:ligancy - chemical notation, a real word
Strickesel (
talk )
1 -
Coordination sphere -
wikt:hexamminecobalt(III - chemical notation
Strickesel (
talk )
3 -
Copper aspirinate -
wikt:Copper(II ,
wikt:copper(II ,
wikt:copper(II - chemical notation
Strickesel (
talk )
2 -
Copper benzoate -
wikt:Copper(II ,
wikt:copper(II - chemical notation
Strickesel (
talk )
1 -
Copper bromide -
wikt:Copper(II - chemical notation
Strickesel (
talk )
1 -
Copper carbonate -
wikt:Copper(II - chemical notation
Strickesel (
talk )
1 -
Copper chloride -
wikt:Copper(II - chemical notation
Strickesel (
talk )
2 -
Copper chromite -
wikt:copper(II ,
wikt:sebacion - chemical notation, second is probably a real word
Strickesel (
talk )
2 -
Copper coulometer -
wikt:copper(II ,
wikt:copper(II - chemical notation
Strickesel (
talk )
1 -
Copper fluoride -
wikt:Copper(II - chemical notation
Strickesel (
talk )
2 -
Copper ibuprofenate -
wikt:copper(II ,
wikt:copper(II - chemical notation
Strickesel (
talk )
3 -
Copper monosulfide -
wikt:copper(II ,
wikt:copper(II ,
wikt:copper(II - chemical notation
Strickesel (
talk )
1 -
Copper nanoparticle -
wikt:copper(II - chemical notation
Strickesel (
talk )
2 -
Copper oxide -
wikt:Copper(II ,
wikt:Copper(III - chemical notation
Strickesel (
talk )
2 -
Copper peptide GHK-Cu -
wikt:copper(II ,
wikt:copper(II - chemical notation
Strickesel (
talk )
1 -
Copper phosphate -
wikt:Copper(II - chemical notation
Strickesel (
talk )
1 -
Copper sulfate -
wikt:Copper(II - chemical notation
Strickesel (
talk )
2 -
Copper(I) bromide -
wikt:copper(II ,
wikt:copper(II - chemical notation
Strickesel (
talk )
4 -
Copper(I) chloride -
wikt:copper(II ,
wikt:mercury(II ,
wikt:copper(II ,
wikt:copper(II - chemical notation
Strickesel (
talk )
5 -
Copper(I) cyanide -
wikt:copper(II ,
wikt:copper(II ,
wikt:copper(II , Li[RCuCN, Li[RCuCN - chemical notation
Strickesel (
talk )
1 -
Copper(I) fluoride -
wikt:copper(II - chemical notation
Strickesel (
talk )
2 -
Copper(I) hydroxide -
wikt:iron(II ,
wikt:copper(II - chemical notation
Strickesel (
talk )
3 -
Copper(I) iodide -
wikt:copper(II ,
wikt:copper(II ,
wikt:palladium(II - chemical notation
Strickesel (
talk )
6 -
Copper(I) oxide -
wikt:copper(II ,
wikt:copper(II ,
wikt:copper(II ,
wikt:copper(II ,
wikt:copper(II ,
wikt:copper(II - chemical notation
Strickesel (
talk )
2 -
Copper(I) sulfate -
wikt:copper(II ,
wikt:copper(II - chemical notation
Strickesel (
talk )
5 -
Copper(I) thiocyanate -
wikt:copper(II ,
wikt:copper(II ,
wikt:copper(II ,
wikt:copper(II ,
wikt:copper(II - chemical notation
Strickesel (
talk )
10 -
Copper(II) acetate -
wikt:Copper(II ,
wikt:copper(II ,
wikt:Copper(II ,
wikt:copper(II ,
wikt:copper(II ,
wikt:copper(II ,
wikt:copper(II ,
wikt:copper(II ,
wikt:Copper(II ,
wikt:copper(II - chemical notation
Strickesel (
talk )
2 -
Copper(II) acetylacetonate -
wikt:Copper(II ,
wikt:copper(II - chemical notation
Strickesel (
talk )
2 -
Copper(II) azide -
wikt:Copper(II ,
wikt:copper(II - chemical notation
Strickesel (
talk )
6 -
Copper(II) bromide -
wikt:Copper(II ,
wikt:Copper(II ,
wikt:Copper(II ,
wikt:Copper(II ,
wikt:Copper(II ,
wikt:Copper(II - chemical notation
Strickesel (
talk )
8 -
Copper(II) fluoride -
wikt:Copper(II ,
wikt:Copper(II ,
wikt:copper(II ,
wikt:Copper(II ,
wikt:Copper(II ,
wikt:Copper(II ,
wikt:copper(II ,
wikt:copper(II - chemical notation
Strickesel (
talk )
3 -
Copper(II) glycinate -
wikt:Copper(II ,
wikt:copper(II ,
wikt:Cu(glycinate - chemical notation
Strickesel (
talk )
10 -
Copper(II) nitrate -
wikt:Copper(II ,
wikt:copper(II ,
wikt:copper(II ,
wikt:copper(II ,
wikt:copper(II ,
wikt:copper(II ,
wikt:copper(II ,
wikt:copper(II ,
wikt:Copper(II ,
wikt:copper(II - chemical notation
Strickesel (
talk )
2 -
Copper(II) perchlorate -
wikt:Copper(II ,
wikt:copper(II - chemical notation
Strickesel (
talk )
3 -
Copper(II) phosphate -
wikt:Copper(II ,
wikt:copper(II ,
wikt:copper(II - chemical notation
Strickesel (
talk )
4 -
Copper(II) selenite -
wikt:Copper(II ,
wikt:Copper(II ,
wikt:copper(II ,
wikt:Copper(II - chemical notation
Strickesel (
talk )
2 -
Copper(II) tetrafluoroborate -
wikt:Copper(II ,
wikt:copper(II - chemical notation
Strickesel (
talk )
2 -
Copper(II) triflate -
wikt:copper(II ,
wikt:rhodium(II - chemical notation
Strickesel (
talk )
4 -
Copper(III) oxide -
wikt:Copper(III ,
wikt:Copper(III ,
wikt:Copper(III ,
wikt:hexafluorocuprate(III - chemical notation
Strickesel (
talk )
2 -
Copperas works -
wikt:Iron(II ,
wikt:iron(II - chemical notation
Strickesel (
talk )
4 -
Copper–copper(II) sulfate electrode -
wikt:copper(II ,
wikt:copper(II ,
wikt:copper(II ,
wikt:copper(II - chemical notation
Strickesel (
talk )
1 -
Corcovado National Park -
wikt:jolillo - some type of forest
Strickesel (
talk )
3 -
Core–shell semiconductor nanocrystal -
wikt:unpassivated ,
wikt:unpassivated ,
wikt:unpassivated - a real word
Strickesel (
talk )
2 -
Corita Kent -
wikt:ad)ical ,
wikt:your - R(ad)ical, and second part of a title
Strickesel (
talk )
3 -
Corium (nuclear reactor) -
wikt:indium(III ,
wikt:neodymium(III ,
wikt:chromium(III - chemical notations
Strickesel (
talk )
6 -
Cornelia Supera - CORNEL[IA, AVG[VSTA, CORNEL[IA, AVG[VSTA, COR[NELIA, AV[GVSTA - latin abbreviations
Strickesel (
talk )
1 -
Cornelis Jan Witsen -
wikt:Witsz(en - correct
Strickesel (
talk )
1 -
Corneliu Coposu -
wikt:in)famous - correct
Strickesel (
talk )
2 -
Cornelius Cardew - Hat[Now, Hat[Now - seem to be part of a title
Strickesel (
talk )
1 -
Cornell Big Red Pep Band -
wikt:in)famous - correct
Strickesel (
talk )
1 -
Coronagraph -
wikt:vector(ial - correct
Strickesel (
talk )
2 -
Coronaviridae -
wikt:glyco)protein ,
wikt:letovirus - first is intentional, second part of a name
Strickesel (
talk )
2 -
Coronene - benzo[10, bc]coronene - part of a chemical notation
Strickesel (
talk )
1 -
Correns -
wikt:Bio(logique - correct
Strickesel (
talk )
7 -
Cortinarius violaceus -
wikt:iron(III ,
wikt:µm ,
wikt:µm ,
wikt:µm ,
wikt:µm ,
wikt:µm ,
wikt:µm - first is correct, second could not figure out how to use unicode
Strickesel (
talk )
1 -
Cortney Lance Bledsoe -
wikt:_____(Want - seemingly a title of poetry
Strickesel (
talk )
1 -
Corvallis High School (California) -
wikt:cor(da - seems correct
Strickesel (
talk )
4 -
Cosmopterix -
wikt:sub)costal ,
wikt:sub)dorsal ,
wikt:sub)costal ,
wikt:sub)dorsal - all correct
Strickesel (
talk )
3 -
Costa Grande of Guerrero -
wikt:tortugeros (probably OK:
wikt:enchhistoria ,
wikt:sociorural ) - first is correct, I believe, other two I deleted because they made no sense with the context
Strickesel (
talk )
7 -
Costa Rica national football team results (2010–19) -
wikt:Coach(es ,
wikt:Coach(es ,
wikt:Coach(es ,
wikt:Coach(es ,
wikt:Coach(es ,
wikt:Coach(es ,
wikt:Coach(es - all correct
Strickesel (
talk )
5 -
Costoboci -
wikt:FIL(iae ,
wikt:CARISS(imae ,
wikt:FECER(unt ,
wikt:kʷek̂ ,
wikt:kʷōk̂ - first three latin inscriptions, last two don't know how to fix
Strickesel (
talk )
2 -
Cotunnite -
wikt:lead(II ,
wikt:sofiite - all correct
Strickesel (
talk )
1 -
Council of the European Union -
wikt:con)formations - correct
Strickesel (
talk )
2 -
Counter-IED efforts - (probably OK:
wikt:emplacer ) - not sure if okay
Strickesel (
talk )
1 -
Counting sort - count[key - correct
Strickesel (
talk )
3 -
Country of origin - OFFI[ci, LIQU[minis, SCOM[bri - latin inscriptions
Strickesel (
talk )
4 -
Coverage map -
wikt:VHF(FM ,
wikt:VHF(FM ,
wikt:µV/m ,
wikt:µV/m - first two correct, last two don't know how to fix
Strickesel (
talk )
2 -
Cowbridge Grammar School -
wikt:auto)biographies ,
wikt:your - first is correct, second part of a title
2 -
Craniofrontonasal dysplasia -
wikt:trans)membrane - (trans)membrane
Strickesel (
talk )
1 -
Creativity and mental health -
wikt:hypo)mania - (hypo)mania
Strickesel (
talk )
1 -
Credit River -
wikt:overpass(es - overpass(es)
Strickesel (
talk )
1 -
Crichtonpelta -
wikt:quadrato)jugal - (quadrato)jugal
Strickesel (
talk )
1 -
Crime of passion -
wikt:Rec(2002 - Rec(2002)5, the name of a recommendation of the council of europe
Strickesel (
talk )
1 -
Crimean Tatar language -
wikt:sub)groups - (sub)groups
Strickesel (
talk )
1 -
Crimp -
wikt:Crimp(ing - Crimp(ing)
Strickesel (
talk )
1 -
Crisaborole -
wikt:yl)oxy - part of a chemical notation
Strickesel (
talk )
2 -
Crocoite -
wikt:lead(II ,
wikt:crocoise - first is a chemical notation, second is the original name
Strickesel (
talk )
2 -
Crofelemer -
wikt:epi)catechin ,
wikt:epi)gallocatechin - chemical notations
Strickesel (
talk )
4 -
Cross electrophile coupling -
wikt:diorganonickel(III ,
wikt:pseudo)halide ,
wikt:nickel(II ,
wikt:palladium(II - chemical notations
Strickesel (
talk )
1 -
Crossmyloof -
wikt:Ma)lieu - (Ma)lieu, a possible name origin
Strickesel (
talk )
1 -
Crossoona Rath -
wikt:semi)historical - (semi)historical
Strickesel (
talk )
11 -
Crossover experiment (chemistry) -
wikt:Pd(dppe ,
wikt:Pd(transphos ,
wikt:Pd(dppe ,
wikt:Pd(PPh ,
wikt:Pd(transphos ,
wikt:Pd(transphos , OH]isocitrate,
wikt:transphos ,
wikt:transphos ,
wikt:transphos ,
wikt:transphos - all part of chemical notations
Strickesel (
talk )
2 -
Crosswind -
wikt:sin(45 ,
wikt:cos(45 - mathematical notation
Strickesel (
talk )
1 -
Crossworlds -
wikt:Joe(seph - Joe(seph)
Strickesel (
talk )
1 -
Crotalus pusillus -
wikt:B1ab(iii - a classification
Strickesel (
talk )
1 -
Crotalus stejnegeri -
wikt:B1ab(iii - a classification
Strickesel (
talk )
1 -
Crotonic acid -
wikt:mercury(II - chemical notation
Strickesel (
talk )
2 -
CrushFTP Server -
wikt:FTP(ES ,
wikt:FTP(ES - correct
Strickesel (
talk )
1 -
Cry (disambiguation) -
wikt:Cry(ing - correct
Strickesel (
talk )
1 -
Cryptmount -
wikt:un)mounted - correct
Strickesel (
talk )
5 -
Cubix -
wikt:robotist - should be a word
Strickesel (
talk )
2 -
Culture of Algeria -
wikt:chtitha ,
wikt:liberately - first is some kind of food, second unsure what was meant
Strickesel (
talk )
1 -
Culture of Palestine -
wikt:kinafe - a middle-eastern dessert
Strickesel (
talk )
14 -
Cuprate -
wikt:copper(III ,
wikt:copper(II ,
wikt:copper(II ,
wikt:copper(III ,
wikt:copper(IV ,
wikt:Copper(II ,
wikt:trichlorocuprate(II ,
wikt:tetrachlorocuprate(II ,
wikt:pentachlorocuprate(II ,
wikt:copper(II ,
wikt:copper(III ,
wikt:copper(IV ,
wikt:hexafluorocuprate(III ,
wikt:hexafluorocuprate(IV - chemical notation
Strickesel (
talk )
1 -
Cupriavidus metallidurans -
wikt:gold(III - chemical notation
Strickesel (
talk )
1 -
Curium(III) fluoride -
wikt:Curium(III - chemical notation
Strickesel (
talk )
1 -
Customer (Dis)Service -
wikt:Dis)Service - correct
Strickesel (
talk )
2 -
Cyanate -
wikt:Rh(PPh ,
wikt:Rh(PPh - chemical notation
Strickesel (
talk )
3 -
Cyanocobalamin reductase (cyanide-eliminating) -
wikt:cyanocob(III ,
wikt:cyanocob(III ,
wikt:cyanocob(III - chemical notation
Strickesel (
talk )
4 -
Cyanonickelate -
wikt:Tetracyanonickelate(II ,
wikt:tetracyanonickelate(III ,
wikt:Tetracyanonickelate(III ,
wikt:hexacyanonickelate(III - chemical notation
Strickesel (
talk )
4 -
Cyanotype -
wikt:iron(III ,
wikt:iron(II ,
wikt:iron(II ,
wikt:iron(III - chemical notation
Strickesel (
talk )
3 -
Cyclic homology -
wikt:co)homology ,
wikt:co)homology ,
wikt:co)homology - correct
Strickesel (
talk )
1 -
Cyclin E -
wikt:p220(NPAT - chemical notation
Strickesel (
talk )
2 -
Cyclin E2 -
wikt:p27(Kip1 ,
wikt:p21(Cip1 - chemical notation
Strickesel (
talk )
1 -
Cyclin-dependent kinase 4 -
wikt:p16(INK4a - chemical notation
Strickesel (
talk )
2 -
Cyclo(18)carbon - cyclo[18, Cyclo[18 - chemical notation
Strickesel (
talk )
2 -
Cycloaddition -
wikt:pyridyl)ethene , Iron[pyridine - chemical notation
Strickesel (
talk )
1 -
Cyclobis(paraquat-p-phenylene) -
wikt:methoxyethoxy)ethoxy - chemical notation
Strickesel (
talk )
1 -
Cyclocarbon - Cyclo[18 - chemical notation
Strickesel (
talk )
3 -
Cyclodecapentaene - methano[10, tricyclic[10, tricyclic[10 - chemical notation
Strickesel (
talk )
1 -
Cyclohexa-1,3-diene -
wikt:Benzene)ruthenium - chemical notation
Strickesel (
talk )
1 -
Cyclonic separation -
wikt:air)flow - correct
Strickesel (
talk )
6 -
Cyclooctadiene rhodium chloride dimer -
wikt:RhCl(COD ,
wikt:RhCl(COD ,
wikt:RhCl(COD ,
wikt:RhCl(COD ,
wikt:RhCl(COD ,
wikt:Rh(COD - chemical notation
Strickesel (
talk )
3 -
Cyclooctatetraene -
wikt:mercury(II ,
wikt:Fe(COT ,
wikt:Fe(COT - chemical notation
Strickesel (
talk )
1 -
Cyclopentadiene -
wikt:nickel(II - chemical notation
Strickesel (
talk )
3 -
Cyclopentadienyl allyl palladium -
wikt:Pd(CNR ,
wikt:CpPd(allyl ,
wikt:Pd(PR - chemical notation
Strickesel (
talk )
1 -
Cyclopentadienylchromium tricarbonyl dimer -
wikt:CpCr(CO - chemical notation
Strickesel (
talk )
1 -
Cyclopentadienyliron dicarbonyl iodide -
wikt:CpFe(CO - chemical notation
Strickesel (
talk )
1 -
Cyclopentamine -
wikt:meth)amphetamine - chemical notation
Strickesel (
talk )
1 -
Cycloprop-2-ene carboxylic acid -
wikt:oyl)oxazolidinones - chemical notation
Strickesel (
talk )
1 -
Cyclotomic unit -
wikt:exp(2πia - mathematical notation
Strickesel (
talk )
4 -
Cyrrhus -
wikt:arch)bishopric ,
wikt:Arch)Bishops ,
wikt:Cyrrhen(sis ,
wikt:Cyrrhen(sis - both correct
Strickesel (
talk )
2 -
Cytochrome P450 engineering -
wikt:Ir(Me ,
wikt:Ir(Me - part of a chemical notation
Strickesel (
talk )
3 -
Cytochrome c oxidase -
wikt:Tyr(244 ,
wikt:His(240 ,
wikt:Tyr(244 - part of a chemical notation
Strickesel (
talk )
2 -
Cytochrome d - ubiquinol[inner, ubiquinone[inner - part of a chemical notation
Strickesel (
talk )
1 -
Cytogenetics -
wikt:CLSp(CG - seems intentional
Strickesel (
talk )
1 -
Cúcuta -
wikt:clemones - apparently a type of tree
Strickesel (
talk )
T1+
1 -
DMSO reductase -
wikt:dorC : the name of a gene.
Ira Leviton (
talk ) 15:49, 2 September 2020 (UTC)
reply
3 -
DNA barcoding in diet assessment -
wikt:trnL ,
wikt:trnL ,
wikt:trnL : names of genes.
Ira Leviton (
talk ) 15:49, 2 September 2020 (UTC)
reply
7 -
DNA repair protein XRCC4 -
wikt:V(D) ,
wikt:V(D) ,
wikt:V(D) ,
wikt:V(D) ,
wikt:V(D) , p]harmacological,
wikt:harmacological : molecular biology jargon and brackets to clarify a quotation.
Ira Leviton (
talk ) 15:49, 2 September 2020 (UTC)
reply
1 -
DNA virus -
wikt:bipartate : a biology term.
Ira Leviton (
talk ) 15:49, 2 September 2020 (UTC)
reply
3 -
DNA-3-methyladenine glycosylase -
wikt:a(EUCOMM) : part of a molecular biology term.
Ira Leviton (
talk ) 15:49, 2 September 2020 (UTC)
reply
5 -
Da (Indic) -
wikt:ddra ,
wikt:ddva ,
wikt:ndva ,
wikt:ndya ,
wikt:rdra : I don't know enough about Indic script to figure out the proper language tags.
Ira Leviton (
talk ) 17:33, 2 September 2020 (UTC)
reply
1 -
Dagestan -
wikt:koisy : probably a Russian transliteration.
Ira Leviton (
talk ) 17:33, 2 September 2020 (UTC)
reply
4 -
Dagga -
wikt:daggha ,
wikt:dachka ,
wikt:twaga ,
wikt:toaga : different ways of spelling the subject of the page in other languages, but the languages are not mentioned.
Ira Leviton (
talk )
1 -
Dahl's toad-headed turtle -
wikt:pect : an abbreviation, possibly pectoral or something similar.
Ira Leviton (
talk ) 17:33, 2 September 2020 (UTC)
reply
2 -
Dahlbominus fuscipennis -
wikt:eonymph : a stage in the development of some insects.
Ira Leviton (
talk ) 17:33, 2 September 2020 (UTC)
reply
1 -
Dakacha -
wikt:maengo : unclear language.
Ira Leviton (
talk ) 13:12, 3 September 2020 (UTC)
reply
1 -
Daldøs - wikt:undalled]]: an in-universe term.
Ira Leviton (
talk ) 20:35, 3 September 2020 (UTC)
reply
1 -
Damian Woetzel -
wikt:RE(NEW) : an acronym.
Ira Leviton (
talk ) 20:35, 3 September 2020 (UTC)
reply
1 -
Dar (disk archiver) -
wikt:gdar : software jargon.
Ira Leviton (
talk ) 01:00, 4 September 2020 (UTC)
reply
25 -
Darboux frame -
wikt:ωi,ωij ,
wikt:ωi,ωji ,
wikt:P(s) ,
wikt:P(s ,
wikt:F(n) ,
wikt:F(n) ,
wikt:Euc(n) ,
wikt:F(n) ,
wikt:Euc(n) ,
wikt:F(n) ,
wikt:F(n) ,
wikt:F(n) ,
wikt:F(n) ,
wikt:F(n) ,
wikt:n(n ,
wikt:F(n) ,
wikt:F(M) ,
wikt:F(M) ,
wikt:O(p) ,
wikt:O(n ,
wikt:F(n) ,
wikt:F(n) ,
wikt:F(n) ,
wikt:ddei ,
wikt:ddei : mathematical formulas.
Ira Leviton (
talk ) 01:00, 4 September 2020 (UTC)
reply
2 -
Darbuka (disambiguation) -
wikt:debuka ,
wikt:dumbelek : other names for the subject of the page, but in unknown languages.
Ira Leviton (
talk ) 01:00, 4 September 2020 (UTC)
reply
1 -
Darik's Boot and Nuke -
wikt:shredos : appears to be the name of a software program.
Ira Leviton (
talk ) 01:00, 4 September 2020 (UTC)
reply
5 -
Dark Benediction -
wikt:dermies ,
wikt:dermies : an in-universe term.
Ira Leviton (
talk ) 01:00, 4 September 2020 (UTC)
reply
2 -
Dark Carnival (novel) -
wikt:wrinklie : an in-universe term.
Ira Leviton (
talk ) 01:00, 4 September 2020 (UTC)
reply
2 -
Darwinia (plant) -
wikt:darwinias -plural of the subject of the page (and OK with lower case).
Ira Leviton (
talk ) 01:00, 4 September 2020 (UTC)
reply
1 -
David Coulthard -
wikt:trepassed : unclear meaning, tagged.
Ira Leviton (
talk ) 15:13, 4 September 2020 (UTC)
reply
1 -
David Duchovny -
wikt:chemistri : apparently the name of an advertising agency.
Ira Leviton (
talk ) 15:13, 4 September 2020 (UTC)
reply
3 -
David Ross Locke -
wikt:impendin ,
wikt:condishun ,
wikt:reesons : intentional misspellings in a title.
Ira Leviton (
talk ) 15:13, 4 September 2020 (UTC)
reply
1 -
David Thesmar -
wikt:organistic : not a typo.
Ira Leviton (
talk ) 15:13, 4 September 2020 (UTC)
reply
1 -
Deadshot -
wikt:nanoexplosives : an in-universe term.
Ira Leviton (
talk ) 18:33, 4 September 2020 (UTC)
reply
7 -
Death Gate -
wikt:tytans ,
wikt:tytans ,
wikt:tytans ,
wikt:tytans ,
wikt:tytans ,
wikt:tytans ,
wikt:tytans : an in-universe term.
Ira Leviton (
talk ) 18:33, 4 September 2020 (UTC)
reply
4 -
Deb (file format) -
wikt:use .ipk ,
wikt:conffiles ,
wikt:prerm : a software file suffix and software jargon.
Ira Leviton (
talk ) 18:33, 4 September 2020 (UTC)
reply
3 -
Debromoaplysiatoxin -
wikt:diolide : a type of chemical.
Ira Leviton (
talk ) 18:33, 4 September 2020 (UTC)
reply
5 -
Deer -
wikt:cervoids ,
wikt:rangiferines ,
wikt:hydropotines : all are OK.
Ira Leviton (
talk ) 22:11, 4 September 2020 (UTC)
reply
7 -
Deer hay wind -
wikt:elricks ,
wikt:elricks ,
wikt:wynding ,
wikt:elricks ,
wikt:elricks ,
wikt:wynding ,
wikt:elricks : probably Gaelic, but I'm not sure.
Ira Leviton (
talk ) 22:11, 4 September 2020 (UTC)
reply
5 -
Delta update -
wikt:bsdiff ,
wikt:deltarpms ,
wikt:bsdiff ,
wikt:bsdiff ,
wikt:bsdiff : software jargon.
Ira Leviton (
talk ) 22:11, 4 September 2020 (UTC)
reply
1 -
Denial-of-service attack -
wikt:monlist : some type of technology jargon.
Ira Leviton (
talk ) 02:30, 5 September 2020 (UTC)
reply
1 -
Dentistry -
wikt:geriodontics : a legit word.
Ira Leviton (
talk ) 02:30, 5 September 2020 (UTC)
reply
1 -
Derbe -
wikt:praefecture : not sure if this or prefecture is correct, the citation is not linked.
Ira Leviton (
talk ) 03:40, 6 September 2020 (UTC)
reply
2 -
Derlin-1 -
wikt:derlins ,
wikt:derlins : the name of a family of proteins.
Ira Leviton (
talk ) 03:40, 6 September 2020 (UTC)
reply
2 -
Desizing -
wikt:desized : seems legit - see the title of the page.
Ira Leviton (
talk ) 03:40, 6 September 2020 (UTC)
reply
2 -
Detarium microcarpum -
wikt:dattock ,
wikt:dattock : unclear local language.
Ira Leviton (
talk ) 03:40, 6 September 2020 (UTC)
reply
4 -
Deterministic finite automaton -
wikt:anbn : mathematical notation.
Ira Leviton (
talk ) 03:40, 6 September 2020 (UTC)
reply
1 -
Deutscher Eisenbahn-Verein -
wikt:rollbocks : a legit word.
Ira Leviton (
talk ) 20:22, 2 September 2020 (UTC)
reply
2 -
Developable roller -
wikt:hexacon ,
wikt:platonicons : legitimate words in topology.
Ira Leviton (
talk ) 20:22, 2 September 2020 (UTC)
reply
1 -
Development of the cerebral cortex -
wikt:nudF : the name of a gene.
Ira Leviton (
talk ) 20:22, 2 September 2020 (UTC)
reply
1 -
Device file -
wikt:devd : computer jargon.
Ira Leviton (
talk ) 20:22, 2 September 2020 (UTC)
reply
2 -
Df (Unix) -
wikt:statfs ,
wikt:statvfs : software jargon.
Ira Leviton (
talk ) 20:22, 2 September 2020 (UTC)
reply
1 -
Diazinon -
wikt:yl)pyrimidin : part of a chemical name.
Ira Leviton (
talk ) 18:25, 8 September 2020 (UTC)
reply
1 -
Dickinson (TV series) -
wikt:wiip : a production company.
CateFromArcadia (
talk ) 15:50, 9 September 2020 (UTC)
reply
1 -
Dictyostelium -
wikt:glorin : a biological term.
CateFromArcadia (
talk ) 15:50, 9 September 2020 (UTC)
reply
32 -
Differential diagnosis -
wikt:Pr(Presentation ,
wikt:Pr(Presentation ,
wikt:Pr(Presentation ,
wikt:Pr(Presentation ,
wikt:Pr(Presentation ,
wikt:Pr(Presentation ,
wikt:Pr(Condition ,
wikt:Pr(Condition ,
wikt:Pr(Condition ,
wikt:P(No ,
wikt:P(PH ,
wikt:Odds(PostBTPH) ,
wikt:Odds(PreBTPH ,
wikt:LH(BT) ,
wikt:Odds(PostBTPH) ,
wikt:Odds(PostH ,
wikt:P(PostH ,
wikt:P(PostH ,
wikt:ascular ,
wikt:nflammatory ,
wikt:nfectious ,
wikt:eoplastic ,
wikt:egenerative ,
wikt:eficiency ,
wikt:diopathic ,
wikt:ntoxication ,
wikt:utoimmune ,
wikt:llergic ,
wikt:raumatic ,
wikt:ndocrine ,
wikt:nvironmental ,
wikt:etabolic : mathematical formulas and mnemonics.
Ira Leviton (
talk ) 02:27, 10 September 2020 (UTC)
reply
3 -
Differential equation -
wikt:desolve(y ,
wikt:desolve ,
wikt:desolve : software programming jargon.
Ira Leviton (
talk ) 02:27, 10 September 2020 (UTC)
reply
2 -
Diffuse large B-cell lymphoma -
wikt:DLBCL,NOS ,
wikt:DLBCL,NOS : biological terms; I'm not sure whether there should be a space here or not.
CateFromArcadia (
talk ) 15:50, 9 September 2020 (UTC)
reply
3 -
Diffusion MRI -
wikt:ln(S ,
wikt:fxy : mathematical notations.
Ira Leviton (
talk ) 02:27, 10 September 2020 (UTC)
reply
20 -
Digermyne -
wikt:N(Si , bis[bis,
wikt:G(d) ,
wikt:digermynes ,
wikt:digermynes ,
wikt:digermynes ,
wikt:digermynes ,
wikt:digermynes ,
wikt:digermynes ,
wikt:digermynes ,
wikt:digermynes ,
wikt:digermynes ,
wikt:digermynes ,
wikt:digermynes ,
wikt:digermynes ,
wikt:germirane ,
wikt:digermynes ,
wikt:digermynes ,
wikt:digermynes ,
wikt:digermynes
3 -
Digital cross connect system -
wikt:transmuxed ,
wikt:transmuxed ,
wikt:transmuxed : a legit word.
Ira Leviton (
talk ) 01:10, 10 September 2020 (UTC)
reply
9 -
Diiminopyridine -
wikt:M(DIP) ,
wikt:M(DIP) ,
wikt:M(DIP) ,
wikt:Fe(DIP) ,
wikt:Fe(DIP) ,
wikt:Fe(DIP) ,
wikt:Fe(DIP) ,
wikt:M(DIP) : chemical formulas.
Ira Leviton (
talk ) 01:10, 10 September 2020 (UTC)
reply
2 -
Diligence (Scots law) -
wikt:furthcoming ,
wikt:furthcoming : a legal term in British English and Scots law.
Ira Leviton (
talk ) 14:39, 11 September 2020 (UTC)
reply
1 -
Dilophosaurus -
wikt:chonoses : an arcane term in dinosaur anatomy (plural).
6 -
Dimensional analysis -
wikt:d(dx , T[F], T[C], T[C], T[F],
wikt:log(a
5 -
Dinocyst -
wikt:chorate ,
wikt:periphragm ,
wikt:periphragm ,
wikt:periphragm ,
wikt:periphragm : biological terms.
CateFromArcadia (
talk ) 20:41, 10 September 2020 (UTC)
reply
1 -
Dinosaucers -
wikt:defossilize = defossilize does appear in places.
1 -
Dioon purpusii - (probably OK:
wikt:sarcotestas ): a term for a seed coat (plural).
Ira Leviton (
talk ) 14:39, 11 September 2020 (UTC)
reply
1 -
Dioxins and dioxin-like compounds -
wikt:benzo(a) : a chemical name.
Ira Leviton (
talk ) 14:39, 11 September 2020 (UTC)
reply
2 -
Dioxolane -
wikt:sporol ,
wikt:sporol : a chemical compound.
CateFromArcadia (
talk ) 18:40, 10 September 2020 (UTC)
reply
3 -
Dioxygenase -
wikt:HXH(X) ,
wikt:PXG(X) ,
wikt:iron(V) : chemistry terms.
Ira Leviton (
talk ) 14:39, 11 September 2020 (UTC)
reply
2 -
Diphosphenes - bis[tris,
wikt:diperoxides : part of a chemical formula, and the name of a chemical class.
Ira Leviton (
talk ) 17:34, 11 September 2020 (UTC)
reply
2 -
Diphthong -
wikt:yodization : a linguistics term.
Ira Leviton (
talk ) 17:34, 11 September 2020 (UTC)
reply
1 -
Dipljapyx beroni -
wikt:entroph : a type of insect.
Ira Leviton (
talk ) 17:34, 11 September 2020 (UTC)
reply
1 -
Dipljapyx fagniezi -
wikt:entroph : a type of insect.
Ira Leviton (
talk ) 17:34, 11 September 2020 (UTC)
reply
1 -
Dipljapyx hirpinus -
wikt:entroph : a type of insect.
Ira Leviton (
talk ) 17:34, 11 September 2020 (UTC)
reply
1 -
Dipljapyx italicus -
wikt:entroph : a type of insect.
Ira Leviton (
talk ) 17:34, 11 September 2020 (UTC)
reply
1 -
Dipljapyx limbarae -
wikt:entroph : a type of insect.
Ira Leviton (
talk ) 17:34, 11 September 2020 (UTC)
reply
1 -
Dipljapyx nexus -
wikt:entroph : a type of insect.
Ira Leviton (
talk ) 17:34, 11 September 2020 (UTC)
reply
1 -
Dipljapyx sardous -
wikt:entroph : a type of insect.
Ira Leviton (
talk ) 17:34, 11 September 2020 (UTC)
reply
1 -
Dipljapyx silanus -
wikt:entroph : a type of insect.
Ira Leviton (
talk ) 17:34, 11 September 2020 (UTC)
reply
3 -
Direction-preserving function -
wikt:ch(X) ,
wikt:ch(X) ,
wikt:ch(X) : parts of mathematical formulas.
Ira Leviton (
talk ) 17:34, 11 September 2020 (UTC)
reply
5 -
Discourse grammar -
wikt:theticals ,
wikt:theticals ,
wikt:theticals ,
wikt:theticals ,
wikt:modalizing : linguistic or grammar terminology.
Ira Leviton (
talk ) 02:06, 9 September 2020 (UTC)
reply
1 -
Discovery and development of non-nucleoside reverse-transcriptase inhibitors -
wikt:phenylthio)thymine : part of a chemical name.
Ira Leviton (
talk ) 02:06, 9 September 2020 (UTC)
reply
7 -
Discovery and development of tubulin inhibitors -
wikt:Ala(P) ,
wikt:Ala(P) ,
wikt:Vla(P) : parts of chemical names.
Ira Leviton (
talk ) 02:06, 9 September 2020 (UTC)
reply
2 -
Discrete category -
wikt:homC(X ,
wikt:homC : parts of mathematical notations.
Ira Leviton (
talk ) 02:06, 9 September 2020 (UTC)
reply
4 -
Discrete-time Markov chain -
wikt:Pr(Xn ,
wikt:Pr(X ,
wikt:Pr(Xn ,
wikt:pji : parts of mathematical notations.
Ira Leviton (
talk ) 02:06, 9 September 2020 (UTC)
reply
11 -
Discworld (world) -
wikt:thaumometer ,
wikt:thaumometer ,
wikt:thaums ,
wikt:fingles ,
wikt:fingles ,
wikt:knurdness ,
wikt:knurdness ,
wikt:rhinu ,
wikt:morporks ,
wikt:unggue ,
wikt:quirma : all in-universe terminology.
Ira Leviton (
talk ) 02:06, 9 September 2020 (UTC)
reply
1 -
Disemvoweling -
wikt:brwn : written deliberately, the article is about removing vowels.
Ira Leviton (
talk ) 02:06, 9 September 2020 (UTC)
reply
1 -
Dissocarpus paradoxus -
wikt:solonized : A legit word.
Ira Leviton (
talk ) 02:06, 9 September 2020 (UTC)
reply
1 -
Diver training -
wikt:unkitting : a Britishism, for removing a uniform or gear (or a kit).
Ira Leviton (
talk ) 17:34, 11 September 2020 (UTC)
reply
3 -
Divide-and-conquer algorithm -
wikt:O(n ,
wikt:logpn : parts of mathematical formulas.
Ira Leviton (
talk ) 17:34, 11 September 2020 (UTC)
reply
1 -
Division of the field -
wikt:tiercing : an obsolete word meaning "dividing into three parts.
Ira Leviton (
talk ) 17:34, 11 September 2020 (UTC)
reply
1 -
Divnogorye -
wikt:petrophytic : a biological term.
CateFromArcadia (
talk ) 08:06, 11 September 2020 (UTC)
reply
2 -
Dizmo AG -
wikt:dizmos ,
wikt:dizmos : a product created by this company (plural).
Ira Leviton (
talk ) 17:34, 11 September 2020 (UTC)
reply
1 -
Djinang people - showing two spellings for a name.
Ira Leviton (
talk ) 17:34, 11 September 2020 (UTC)
reply
3 -
Dmitri Nusinow -
wikt:arrhythmo ,
wikt:phyB ,
wikt:phyB : parts of gene names.
Ira Leviton (
talk ) 17:34, 11 September 2020 (UTC)
reply
5 -
Dog coat genetics -
wikt:sabling ,
wikt:sabling ,
wikt:urajiro ,
wikt:urajiro ,
wikt:urajiro : arcane but legit words.
Ira Leviton (
talk ) 18:10, 10 September 2020 (UTC)
reply
1 -
Dom language -
wikt:take.INF : I'm not sure what's going on here, but it's deliberate and to show grammar and syntax in this language.
Ira Leviton (
talk ) 22:24, 7 September 2020 (UTC)
reply
1 -
Dominica -
wikt:tanias : a vegetable (plural).
Ira Leviton (
talk ) 22:24, 7 September 2020 (UTC)
reply
2 -
Dominican Spanish -
wikt:jaguai ,
wikt:jasguar : misspelled deliberately, to show pronunciations.
Ira Leviton (
talk ) 22:24, 7 September 2020 (UTC)
reply
6 -
Donaldism -
wikt:DDF(R) ,
wikt:DDF(R) ,
wikt:NAFS(K) ,
wikt:NAFS(K) ,
wikt:appet ,
wikt:appet : parts of titles of fan magazines.
Ira Leviton (
talk ) 01:25, 7 September 2020 (UTC)
reply
1 -
Dopamine antagonist - (probably OK:
wikt:prefontal ): corrected to prefrontal.
Ira Leviton (
talk ) 01:25, 7 September 2020 (UTC)
reply
5 -
Dopping cement -
wikt:dopsticks ,
wikt:dopstick ,
wikt:dopstick ,
wikt:dopstick ,
wikt:dopstick : all OK.
Ira Leviton (
talk ) 01:25, 7 September 2020 (UTC)
reply
1 -
Dorylaimida -
wikt:alaims : a group of worms (plural).
Ira Leviton (
talk ) 21:35, 7 September 2020 (UTC)
reply
1 -
Dorylus laevigatus -
wikt:unpupated : a legit word.
Ira Leviton (
talk ) 21:35, 7 September 2020 (UTC)
reply
1 -
Doublecortin -
wikt:doublin : a genetics or molecular biology term.
Ira Leviton (
talk ) 21:35, 7 September 2020 (UTC)
reply
11 -
Doubletime (gene) -
wikt:dbts ,
wikt:dbts ,
wikt:dbtS ,
wikt:dbtS ,
wikt:dbtS ,
wikt:dbtS ,
wikt:dbtS ,
wikt:dbts ,
wikt:dbtS : all are legit.
Ira Leviton (
talk ) 21:35, 7 September 2020 (UTC)
reply
6 -
Doughnut -
wikt:koeks ,
wikt:koeks ,
wikt:tangentic ,
wikt:tangentic : a regional pronunciation and a legit term (I think).
Ira Leviton (
talk ) 21:35, 7 September 2020 (UTC)
reply
1 -
Downstream-peptide motif -
wikt:gifB : the name of a gene.
Ira Leviton (
talk ) 21:35, 7 September 2020 (UTC)
reply
1 -
Dr. Horacio E. Oduber Hospital - (probably OK:
wikt:cathlab ): slang term, I corrected to catheterization laboratory.
Ira Leviton (
talk ) 21:35, 7 September 2020 (UTC)
reply
2 -
Dracontium spruceanum -
wikt:jergon ,
wikt:jergon : a local name for this plant.
Ira Leviton (
talk ) 21:35, 7 September 2020 (UTC)
reply
2 -
Dragon Ball Z Complete Song Collection 2: Incredible Mightiest vs. Mightiest - E[nergy],
wikt:nergy : clarifying that E is for Energy.
Ira Leviton (
talk ) 21:35, 7 September 2020 (UTC)
reply
1 -
Dragon's Kin -
wikt:whers : an in-universe term.
Ira Leviton (
talk ) 21:35, 7 September 2020 (UTC)
reply
5 -
Dreamshell -
wikt:sdiso ,
wikt:fatfs ,
wikt:sdiso ,
wikt:fatfs ,
wikt:luac : software jargon for this video game.
1 -
Drumline -
wikt:gocks : a type of drum (plural).
Ira Leviton (
talk ) 18:55, 6 September 2020 (UTC)
reply
1 -
Dry low emission -
wikt:premixers : a legit word (plural).
Ira Leviton (
talk ) 18:55, 6 September 2020 (UTC)
reply
3 -
Dry milling and fractionation of grain -
wikt:degermination ,
wikt:degermination ,
wikt:degermination : a legit word.
Ira Leviton (
talk ) 18:55, 6 September 2020 (UTC)
reply
13 -
Duffy antigen system -
wikt:Fy(a ,
wikt:Fy(a ,
wikt:Fy(a ,
wikt:Fy(a ,
wikt:Fy(a ,
wikt:Fy(a ,
wikt:Fy(a ,
wikt:Fy(a ,
wikt:Fy(a) ,
wikt:Fy(b) ,
wikt:Fy(a ,
wikt:Fy(a ,
wikt:Fy(a : biology/medical jargon.
Ira Leviton (
talk ) 16:08, 6 September 2020 (UTC)
reply
3 -
Duratrans -
wikt:translites ,
wikt:translites ,
wikt:translites : another word for duratrans, the subject of the page.
Ira Leviton (
talk ) 20:17, 7 September 2020 (UTC)
reply
1 -
Durham Light Infantry -
wikt:nuggers : a type of boat (plural).
Ira Leviton (
talk ) 20:17, 7 September 2020 (UTC)
reply
1 -
Dwarfism in chickens -
wikt:thyrogenous : a medical term.
Ira Leviton (
talk ) 20:17, 7 September 2020 (UTC)
reply
5 -
Dwile flonking -
wikt:flonks ,
wikt:girters ,
wikt:flonks ,
wikt:girters ,
wikt:snurd : terms in the game of dwile flonking.
Ira Leviton (
talk ) 20:17, 7 September 2020 (UTC)
reply
1 -
Dynactin -
wikt:dynamitin : the name of a protein.
Ira Leviton (
talk ) 20:17, 7 September 2020 (UTC)
reply
1 -
Dynamic nuclear polarization -
wikt:dipolarly : seems a legit descriptive word.
Ira Leviton (
talk ) 20:17, 7 September 2020 (UTC)
reply
1 -
Dysart, Fife -
wikt:ogile : unclear, the references for this are not online.
Ira Leviton (
talk ) 20:17, 7 September 2020 (UTC)
reply
3 -
Déborah Heissler -
wikt:Ecri(peind) ,
wikt:effet(s) ,
wikt:peind : parts of poem titles.
Ira Leviton (
talk ) 20:17, 7 September 2020 (UTC)
reply
1 -
Dīghajāṇu Sutta -
wikt:kammic : seems legit.
Ira Leviton (
talk ) 20:17, 7 September 2020 (UTC)
reply
TS+DOT+
1 -
DJ Puzzle -
wikt:iPro.DJSampler : a product name.
Ira Leviton (
talk ) 03:45, 2 September 2020 (UTC)
reply
3 -
DNA-encoded chemical library -
wikt:m)r ,
wikt:amplificability : part of a formula, and molecular biology jargon.
Ira Leviton (
talk ) 03:45, 2 September 2020 (UTC)
reply
1 - Dan Atar -
wikt:i.Br : German style, without a space after the period.
Ira Leviton (
talk ) 02:17, 2 September 2020 (UTC)
reply
4 -
Daniel Cudmore (businessman) -
wikt:J(ames) ,
wikt:J(ames) ,
wikt:T(homas) : showing full names.
Ira Leviton (
talk ) 02:14, 2 September 2020 (UTC)
reply
6 -
Dative construction -
wikt:me.DAT ,
wikt:go.INFIN : abbreviations in linguistics.
Ira Leviton (
talk ) 02:14, 2 September 2020 (UTC)
reply
4 -
Deep chlorophyll maximum -
wikt:pyrrophytes ,
wikt:pyrrophytes ,
wikt:nuricline : chemical names.
3 -
Delta Field (Niger Delta) -
wikt:depobelts ,
wikt:depobelts ,
wikt:depobelts : a geologic term.
Ira Leviton (
talk ) 20:00, 1 September 2020 (UTC)
reply
3 -
Dental composite -
wikt:polyceram ,
wikt:flowables : a chemical name and a plural chemical term.
Ira Leviton (
talk ) 20:00, 1 September 2020 (UTC)
reply
2 -
Diaporthe helianthi -
wikt:telomorphic : a botany or cellular term.
Ira Leviton (
talk ) 03:18, 1 September 2020 (UTC)
reply
2 -
Discovery and development of ACE inhibitors -
wikt:Asp(L) ,
wikt:L)Ala : parts of chemical notations.
Ira Leviton (
talk ) 15:14, 31 August 2020 (UTC)
reply
2 -
Discovery and development of direct Xa inhibitors -
wikt:cyclisizes ,
wikt:arylized : chemistry jargon.
Ira Leviton (
talk ) 15:14, 31 August 2020 (UTC)
reply
1 -
Discovery and development of integrase inhibitors -
wikt:yl)phenyl : part of a chemical name.
Ira Leviton (
talk ) 15:14, 31 August 2020 (UTC)
reply
3 -
Discrete cosine transform -
wikt:O(N ,
wikt:O(N ,
wikt:O(N : Mathematical notations.
Ira Leviton (
talk ) 15:14, 31 August 2020 (UTC)
reply
3 -
Don Tallon with the Australian cricket team in England in 1948 -
wikt:three.N ,
wikt:matches.N ,
wikt:summer.N : the Ns are parts of footnotes written as superscripts.
Ira Leviton (
talk ) 21:02, 30 August 2020 (UTC)
reply
4 -
Double-ended priority queue -
wikt:put(x) ,
wikt:remove(node ,
wikt:remove(node ,
wikt:O(log : mathematical jargon.
Ira Leviton (
talk ) 21:02, 30 August 2020 (UTC)
reply
1 -
Doug Ring with the Australian cricket team in England in 1948 -
wikt:positions.N : the N is part of a footnote written as a superscript.
Ira Leviton (
talk ) 21:50, 30 August 2020 (UTC)
reply
1 -
Dutch Shepherd -
wikt:mondioring : a dog sport, done at dog shows.
Ira Leviton (
talk ) 04:30, 31 August 2020 (UTC)
reply
TS+COMMA+
3 -
DG/L -
wikt:str,length ,
wikt:setcurrent(str ,
wikt:length(str) : software jargon.
Ira Leviton (
talk ) 02:32, 29 August 2020 (UTC)
reply
2 -
DNA transposon -
wikt:V(D) ,
wikt:V(D) : part of a molecular biology abbreviation.
Ira Leviton (
talk ) 02:32, 29 August 2020 (UTC)
reply
42 -
Damerau–Levenshtein distance -
wikt:CA,ABC ,
wikt:CA,ABC ,
wikt:CA,AC ,
wikt:AC,ABC ,
wikt:CA,ABC ,
wikt:LD(CA ,
wikt:OSA(CA ,
wikt:OSA(CA ,
wikt:OSA(AC ,
wikt:OSA(CA ,
wikt:length(a) ,
wikt:length(b) ,
wikt:length(a) ,
wikt:length(b) ,
wikt:length(a) ,
wikt:length(b) ,
wikt:length(a) ,
wikt:length(b) ,
wikt:length(a) , a[i], b[j], d[i,
wikt:minimum(d , d[i, d[i,
wikt:minimum(d , d[length,
wikt:length(b) , d[i,
wikt:minimum(d ,
wikt:length(a) ,
wikt:length(b) , da[i], d[i,
wikt:length(b) , da[b, a[i], b[j], d[i, d[k, d[length,
wikt:length(b) : mathematical notations and formulas.
Ira Leviton (
talk ) 02:32, 29 August 2020 (UTC)
reply
1 -
Dead Cities, Red Seas & Lost Ghosts -
wikt:DeadCities,RedSeas : a style, without a space after the comma.
Ira Leviton (
talk ) 19:16, 29 August 2020 (UTC)
reply
2 -
Dean of Christ Church Cathedral, Dublin -
wikt:W(illiam ,
wikt:War(r) : indication of a full name and an alternative spelling.
Ira Leviton (
talk ) 19:16, 29 August 2020 (UTC)
reply
3 -
Decaprenylphospho-beta-D-ribofuranose 2-oxidase -
wikt:trans,octacis ,
wikt:trans,octacis ,
wikt:trans,octacis : part of chemical names.
Ira Leviton (
talk ) 19:16, 29 August 2020 (UTC)
reply
20 -
Deligne–Lusztig theory -
wikt:λx,λy ,
wikt:X(w) ,
wikt:T(w) ,
wikt:vwF(v) ,
wikt:N(T) ,
wikt:F(u) ,
wikt:T(F) ,
wikt:X(T) ,
wikt:T(w) ,
wikt:X(w) ,
wikt:W(T ,
wikt:W(T ,
wikt:G(u) ,
wikt:Hi(X ,
wikt:G(k) ,
wikt:s(s ,
wikt:s(s ,
wikt:T(w) ,
wikt:X(w) ,
wikt:X(w) : parts of mathematical formulas.
Ira Leviton (
talk ) 19:16, 29 August 2020 (UTC)
reply
1 -
Demonic possession -
wikt:voice,34 : 34 is used as a superscript to indicate a Bible verse.
Ira Leviton (
talk ) 19:16, 29 August 2020 (UTC)
reply
4 -
Dendrocoelum -
wikt:adenodactyl : an organ of this animal.
Ira Leviton (
talk ) 20:44, 29 August 2020 (UTC)
reply
3 -
Dental laser -
wikt:Er,Cr ,
wikt:Er,Cr ,
wikt:Er,Cr : an abbreviation for a type of dental laser.
Ira Leviton (
talk ) 20:44, 29 August 2020 (UTC)
reply
4 -
Departure function -
wikt:v1,T1 ,
wikt:v2,T2 ,
wikt:h(v ,
wikt:h(v : parts of mathematical formulas.
Ira Leviton (
talk ) 20:44, 29 August 2020 (UTC)
reply
3 -
Depth of noncommutative subrings -
wikt:RH,RG ,
wikt:sub)algebra ,
wikt:d(RH : parts of mathematical formulas.
Ira Leviton (
talk ) 20:44, 29 August 2020 (UTC)
reply
3 -
Despoina -
wikt:jo,po ,
wikt:m(ha) ,
wikt:dem(ha) : parts of mathematical formulas.
Ira Leviton (
talk ) 20:44, 29 August 2020 (UTC)
reply
10 -
Determinacy -
wikt:a1,a3 ,
wikt:y0,y1 ,
wikt:game(s) , p[T],
wikt:max(y ,
wikt:ylen(s) ,
wikt:len(s) ,
wikt:G(A ,
wikt:G(A ,
wikt:A ,B : parts of mathematical formulas.
Ira Leviton (
talk ) 20:44, 29 August 2020 (UTC)
reply
5 -
Di-trans,poly-cis-decaprenylcistransferase -
wikt:trans,poly ,
wikt:trans,poly ,
wikt:trans,poly ,
wikt:trans,poly ,
wikt:trans,poly : parts of chemical names.
Ira Leviton (
talk ) 01:13, 30 August 2020 (UTC)
reply
22 -
Dialog manager -
wikt:Speaker,Hearer ,
wikt:Speaker,Predicate ,
wikt:Speaker,Inform ,
wikt:Speaker,Hearer ,
wikt:Hearer,Predicate ,
wikt:Hearer,Wants ,
wikt:Speaker,Knows ,
wikt:Hearer,Predicate ,
wikt:in(SHARED ,
wikt:fst(SHARED ,
wikt:answer(Q ,
wikt:pop(SHARED ,
wikt:reduce(Q ,
wikt:add(SHARED ,
wikt:Inform(Speaker ,
wikt:Knows(Speaker ,
wikt:Wants(Speaker ,
wikt:Inform(Speaker ,
wikt:Knows(Hearer ,
wikt:Believes(Hearer ,
wikt:Wants(Speaker ,
wikt:Knows(Hearer : this article is written in jargon and without context, I can't tell if these terms are correct without spaces prior to the commas or opening parentheses.
Ira Leviton (
talk ) 01:13, 30 August 2020 (UTC)
reply
6 -
Dialogical logic - A[x], A[x], xA[x], A[x, xA[x], A[x: parts of mathematical formulas.
Ira Leviton (
talk ) 01:13, 30 August 2020 (UTC)
reply
2 -
Diamine N-acetyltransferase -
wikt:alpha,omega ,
wikt:alpha,omega : part of a chemical name.
Ira Leviton (
talk ) 01:13, 30 August 2020 (UTC)
reply
1 -
Diaminopimelate dehydrogenase -
wikt:alpha,epsilon : part of an enzyme name.
Ira Leviton (
talk ) 01:13, 30 August 2020 (UTC)
reply
2 -
Dicarboxylic acid -
wikt:c6,c9 ,
wikt:isosebacic : parts of chemical formulas and names.
Ira Leviton (
talk ) 01:13, 30 August 2020 (UTC)
reply
2 -
Diels–Alder reaction -
wikt:cis,trans ,
wikt:dieneophile : parts of chemical names.
Ira Leviton (
talk ) 01:13, 30 August 2020 (UTC)
reply
42 -
Differential forms on a Riemann surface -
wikt:c1,d1 ,
wikt:a1,b1 ,
wikt:eix,eiy ,
wikt:du,dh ,
wikt:f(x ,
wikt:h(y) ,
wikt:f(x ,
wikt:f(x ,
wikt:i(t) ,
wikt:f(z) ,
wikt:Dx)p ,
wikt:Dy)q ,
wikt:C(T ,
wikt:Hk(T ,
wikt:Hk(T ,
wikt:Hk(T ,
wikt:Hk(T ,
wikt:Hk(T ,
wikt:Hk(T ,
wikt:Hk(T ,
wikt:Hk(T ,
wikt:k(T ,
wikt:Hk(T ,
wikt:k(T ,
wikt:Hk(T ,
wikt:Hk(T ,
wikt:Hk(T ,
wikt:Hj(T ,
wikt:Hk(T ,
wikt:Hj(T ,
wikt:Hk(T ,
wikt:k(T ,
wikt:k(T ,
wikt:k(T ,
wikt:k(T ,
wikt:k(T ,
wikt:Cc(X) ,
wikt:Cc(X) ,
wikt:d(da) ,
wikt:u(z) ,
wikt:D(z) ,
wikt:d(z : parts of mathematical formulas.
Ira Leviton (
talk ) 02:54, 30 August 2020 (UTC)
reply
1 -
Differential group delay -
wikt:ET,total : mathematical notation.
Ira Leviton (
talk ) 02:54, 30 August 2020 (UTC)
reply
2 -
Dimensionless momentum-depth relationship in open-channel flow -
wikt:uMmin ,
wikt:uMmin : mathematical notations.
Ira Leviton (
talk ) 02:54, 30 August 2020 (UTC)
reply
4 -
Dinesh Subasinghe -
wikt:T(H) ,
wikt:T(H) ,
wikt:T(H) ,
wikt:kingiri : part of a title of an album, and a musical instrument.
Ira Leviton (
talk ) 02:54, 30 August 2020 (UTC)
reply
2 -
Dir (princely state) - [wikt:D(h)]],
wikt:Jando(o) : showing alternative spellings.
Ira Leviton (
talk ) 02:54, 30 August 2020 (UTC)
reply
4 -
Discovery and development of cyclooxygenase 2 inhibitors -
wikt:thromboxane(s) ,
wikt:superoxide(O ,
wikt:cis-3,4-dihydrorofecoxib ,
wikt:trans-3,4-dihydrorofecoxib : parts of chemical names.
Ira Leviton (
talk ) 17:28, 30 August 2020 (UTC)
reply
9 -
Disjoint-set data structure -
wikt:v1,v2 ,
wikt:Find(x) ,
wikt:Union(x ,
wikt:O(log ,
wikt:O(log ,
wikt:O(m ,
wikt:O(m) ,
wikt:O(mlog ,
wikt:O(m : parts of mathematical formulas.
Ira Leviton (
talk ) 17:28, 30 August 2020 (UTC)
reply
1 -
Dispersin B -
wikt:PNAG,PS : molecular biolgy jargon.
Ira Leviton (
talk ) 17:28, 30 August 2020 (UTC)
reply
1 -
Display contrast -
wikt:CR,CM : mathematical notation.
Ira Leviton (
talk ) 17:28, 30 August 2020 (UTC)
reply
6 -
Distance from a point to a line -
wikt:x0,y0 ,
wikt:x0,y0 ,
wikt:x1,y1 ,
wikt:x2,y2 ,
wikt:x0,y0 ,
wikt:x0,y0 : mathematical notations.
Ira Leviton (
talk ) 17:28, 30 August 2020 (UTC)
reply
1 -
Divinylcyclopropane-cycloheptadiene rearrangement -
wikt:cis,trans : chemistry terminology, correct with no space after the comma.
Ira Leviton (
talk ) 17:28, 30 August 2020 (UTC)
reply
2 -
Docosanedioic acid -
wikt:carboyoctyl)thiophene ,
wikt:docosa-10,12-diynedoic : parts of chemical formulas.
Ira Leviton (
talk ) 17:28, 30 August 2020 (UTC)
reply
2 -
Dominance order -
wikt:p1,p2 ,
wikt:q1,q2 : mathematical notations.
Ira Leviton (
talk ) 19:00, 30 August 2020 (UTC)
reply
6 -
Douady–Earle extension -
wikt:z1,z3 ,
wikt:z2,z4 ,
wikt:Hf(z) ,
wikt:C(T) ,
wikt:f(z) ,
wikt:f(w) : parts of mathematical formulas.
Ira Leviton (
talk ) 19:00, 30 August 2020 (UTC)
reply
10 -
Double auction -
wikt:sk,bk ,
wikt:bk,sk ,
wikt:sk,bk ,
wikt:bk,sk ,
wikt:buyers,num ,
wikt:max(sk ,
wikt:min(bk ,
wikt:max(sk ,
wikt:min(bk ,
wikt:min(num : mathematical notations.
Ira Leviton (
talk ) 19:00, 30 August 2020 (UTC)
reply
12 -
Doubling-oriented Doche–Icart–Kohel curve -
wikt:x1,y1 ,
wikt:x2,y2 ,
wikt:x3,y3 ,
wikt:x1,y1 ,
wikt:x3,y3 ,
wikt:X1,Y1 ,
wikt:X2,Y2 ,
wikt:x3,y3 , n]P,
wikt:a)x ,
wikt:V(X ,
wikt:a(YY : mathematical notations.
Ira Leviton (
talk ) 19:00, 30 August 2020 (UTC)
reply
4 -
Dowling geometry -
wikt:Bk,αk ,
wikt:Qn(G) ,
wikt:Qn(G) ,
wikt:Qn(G) : mathematical notations.
Ira Leviton (
talk ) 19:00, 30 August 2020 (UTC)
reply
5 -
Dryden Wind Turbulence Model -
wikt:ug,vg ,
wikt:pg,qg ,
wikt:G(s) ,
wikt:y(t) ,
wikt:y(t) : mathematical notations.
Ira Leviton (
talk ) 19:42, 30 August 2020 (UTC)
reply
1 -
Dual of BCH is an independent source -
wikt:BCH2,log : mathematical notation.
Ira Leviton (
talk ) 19:38, 28 August 2020 (UTC)
reply
6 -
Dualizing module -
wikt:x2,y2 ,
wikt:y2,xy ,
wikt:height(m) ,
wikt:height(m) , k[x, k[x: mathematical formulas or parts.
Ira Leviton (
talk ) 19:38, 28 August 2020 (UTC)
reply
2 -
Duchy of Gascony -
wikt:Aznar(i) ,
wikt:Ximen(o) : showing alternative name endings.
Ira Leviton (
talk ) 19:38, 28 August 2020 (UTC)
reply
2 -
Duncan's new multiple range test -
wikt:T3,T2 ,
wikt:T5,T1 : mathematical notations.
Ira Leviton (
talk ) 19:38, 28 August 2020 (UTC)
reply
3 -
Dupin cyclide -
wikt:x1,x2 ,
wikt:x1,x2 ,
wikt:x3,r2 : mathematical notations.
Ira Leviton (
talk ) 19:38, 28 August 2020 (UTC)
reply
2 -
Dvals - ama[r],
wikt:hcawj : no code for Dval language.
Ira Leviton (
talk ) 19:38, 28 August 2020 (UTC)
reply
2 -
DCF77 -
wikt:identifier .DCFa ,
wikt:or .DCFp : software jargon.
Ira Leviton (
talk ) 18:11, 27 August 2020 (UTC)
reply
5 -
DICT -
wikt:a .index ,
wikt:a .dict ,
wikt:or .dict ,
wikt:a .dict ,
wikt:dictfmt : software jargon.
Ira Leviton (
talk ) 18:11, 27 August 2020 (UTC)
reply
2 -
DV -
wikt:are .dv ,
wikt:libdv : software jargon.
Ira Leviton (
talk ) 18:11, 27 August 2020 (UTC)
reply
3 -
Debian configuration system -
wikt:the .templates ,
wikt:the .config ,
wikt:while .postinst : software jargon.
Ira Leviton (
talk ) 02:40, 27 August 2020 (UTC)
reply
1 -
Demon Internet -
wikt:the .demon : part of a url.
Ira Leviton (
talk ) 02:40, 27 August 2020 (UTC)
reply
1 -
Digest access authentication -
wikt:the .htdigest : software jargon.
Ira Leviton (
talk ) 20:06, 27 August 2020 (UTC)
reply
1 -
Digital Video Interactive -
wikt:the .AVS : software file suffix.
Ira Leviton (
talk ) 20:06, 27 August 2020 (UTC)
reply
1 -
Digital rights management -
wikt:s .azw4 : software jargon.
Ira Leviton (
talk ) 20:06, 27 August 2020 (UTC)
reply
1 -
Domain generation algorithm -
wikt:and .b : software jargon.
Ira Leviton (
talk ) 20:49, 27 August 2020 (UTC)
reply
9 -
Domain hack -
wikt:and .le ,
wikt:create .its : software instructions.
Ira Leviton (
talk ) 20:49, 27 August 2020 (UTC)
reply
2 -
Dynamic cascading style sheets -
wikt:A .dcss ,
wikt:included .dcss : software jargon.
Ira Leviton (
talk ) 20:49, 27 August 2020 (UTC)
reply
4 -
Dál Fiatach -
wikt:F)iatach ,
wikt:iatach : written deliberately as (F)iatach because of uncertainty about the first letter.
Ira Leviton (
talk ) 20:49, 27 August 2020 (UTC)
reply
HB+
TS+ DOT+
DX-Daj
1 -
Damn Small Linux -
wikt:in .uci : software jargon.
Ira Leviton (
talk ) 15:40, 6 February 2020 (UTC)
reply
1 -
Damn Vulnerable Linux -
wikt:Slackware .tgz : software jargon.
Ira Leviton (
talk ) 15:40, 6 February 2020 (UTC)
reply
2 -
Dan Blocker -
wikt:Colt .45 ,
wikt:how's : gun name, inadvertent detection of "show's"".
3 -
Daniel Koren -
wikt:how's ,
wikt:it's ,
wikt:he's : inadvertent detection of "show's", words in titles of albums.
Ira Leviton (
talk ) 02:55, 9 February 2020 (UTC)
reply
1 -
Daniel Rey -
wikt:ell.Out : written deliberately as "$ell.Out."
1 -
Danish UNIX User Group -
wikt:the .dk : referring to the .dk internet address suffix.
4 -
Darbuka Siva -
wikt:how's : inadvertent detection of "show's".
Ira Leviton (
talk ) 01:48, 11 February 2020 (UTC)
reply
2 -
Darcy Burner -
wikt:Microsoft .NET ,
wikt:on .NET : software jargon.
Ira Leviton (
talk ) 01:48, 11 February 2020 (UTC)
reply
1 -
DarkOrbit -
wikt:it's : inadvertent detection of "Orbit's".
Ira Leviton (
talk ) 01:48, 11 February 2020 (UTC)
reply
1 -
Darlington F.C. -
wikt:here's : inadvertent detection of "There's" in the title of a magazine.
Ira Leviton (
talk ) 01:48, 11 February 2020 (UTC)
reply
1 -
Data Interchange Format -
wikt:a .dif : software jargon.
Ira Leviton (
talk ) 22:28, 11 February 2020 (UTC)
reply
1 -
Data Moving Tool -
wikt:Microsoft .NET : software jargon.
Ira Leviton (
talk ) 22:28, 11 February 2020 (UTC)
reply
2 -
Data analysis -
wikt:A .NET : software jargon.
Ira Leviton (
talk ) 22:28, 11 February 2020 (UTC)
reply
1 -
Data codes for Switzerland -
wikt:see .ch : software jargon.
Ira Leviton (
talk ) 22:28, 11 February 2020 (UTC)
reply
1 -
Data position measurement -
wikt:the .mds : software jargon.
Ira Leviton (
talk ) 22:28, 11 February 2020 (UTC)
reply
1 -
Data structure -
wikt:Microsoft .NET : software jargon.
Ira Leviton (
talk ) 22:28, 11 February 2020 (UTC)
reply
2 -
Data2map -
wikt:format .ai ,
wikt:formats .ai : software jargon.
Ira Leviton (
talk ) 22:28, 11 February 2020 (UTC)
reply
1 -
Databank format -
wikt:extension .db : software jargon.
Ira Leviton (
talk ) 22:28, 11 February 2020 (UTC)
reply
1 -
Datafork TrueType -
wikt:extension .dfont : software jargon.
Ira Leviton (
talk ) 22:28, 11 February 2020 (UTC)
reply
1 -
David Gewirtz -
wikt:Outlook .PST : software jargon.
Ira Leviton (
talk ) 22:29, 12 February 2020 (UTC)
reply
1 -
David Peel (musician) -
wikt:called .On : inadvertent detection because of intervening quotation marks. No typo.
Ira Leviton (
talk ) 22:29, 12 February 2020 (UTC)
reply
6 -
David Rossi -
wikt:A1 .45 ,
wikt:how's : gun model, inadvertent detection of "show's".
Ira Leviton (
talk ) 22:29, 12 February 2020 (UTC)
reply
3 -
DbDOS -
wikt:a .BAT ,
wikt:a .EXE : software jargon.
1 -
DeMarlo Hale -
wikt:a .508 : winning percentage.
Ira Leviton (
talk ) 04:13, 16 February 2020 (UTC)
reply
2 -
Death toll of the Nanjing Massacre -
wikt:he's : inadvertent detection of another word, probably "Smythe's".
Ira Leviton (
talk ) 05:01, 16 February 2020 (UTC)
reply
1 -
Deathsmiles -
wikt:as .wav : software jargon.
Ira Leviton (
talk ) 04:48, 16 February 2020 (UTC)
reply
8 -
Deep Zoom -
wikt:a .dzi ,
wikt:or .xml ,
wikt:a .dzc ,
wikt:or .xml ,
wikt:the .dzc ,
wikt:the .dzc ,
wikt:of .dzi : software jargon.
Ira Leviton (
talk ) 20:36, 16 February 2020 (UTC)
reply
3 -
Deep web -
wikt:the .onion ,
wikt:hidden .onion ,
wikt:the .onion : a software suffix.
Ira Leviton (
talk ) 20:36, 16 February 2020 (UTC)
reply
1 -
DeepDotWeb -
wikt:sister .onion : ditto.
Ira Leviton (
talk ) 20:36, 16 February 2020 (UTC)
reply
1 -
Defaults (software) -
wikt:a .plist : software jargon.
Ira Leviton (
talk ) 20:36, 16 February 2020 (UTC)
reply
1 -
Degol Woyane -
wikt:downloaded .GPX : software jargon.
Ira Leviton (
talk ) 20:36, 16 February 2020 (UTC)
reply
2 -
Dehydrogenation -
wikt:iron(III : chemistry notation.
Ira Leviton (
talk ) 01:54, 17 February 2020 (UTC)
reply
2 -
Delaware Fightin' Blue Hens football -
wikt:impressive .747 ,
wikt:a .714 : winning percentages.
Ira Leviton (
talk ) 01:54, 17 February 2020 (UTC)
reply
1 -
Delphi Archaeological Museum -
wikt:hermaic : seems like a legit word, in archaeology.
Ira Leviton (
talk ) 02:26, 17 February 2020 (UTC)
reply
9 -
Demonoid -
wikt:from .com ,
wikt:a .me ,
wikt:a .ph ,
wikt:previous .me ,
wikt:the .ph ,
wikt:the .com ,
wikt:the .me ,
wikt:and .ph ,
wikt:the .com : all are software jargon terms.
Ira Leviton (
talk ) 03:37, 17 February 2020 (UTC)
reply
2 -
Denbigh, Cobbitty -
wikt:corroborrees . Apparently a legit word (and plural).
Ira Leviton (
talk ) 03:37, 17 February 2020 (UTC)
reply
1 -
Deployment descriptor -
wikt:application .ear : software program suffix.
Ira Leviton (
talk ) 18:56, 17 February 2020 (UTC)
reply
7 -
Derek Morgan (Criminal Minds) - (probably OK:
wikt:retconed ): corrected to retconned.
Ira Leviton (
talk ) 23:06, 17 February 2020 (UTC)
reply
2 -
Derrick Shepard (defensive lineman) -
wikt:a .500 ,
wikt:Their .500 : winning percentages.
Ira Leviton (
talk ) 23:06, 17 February 2020 (UTC)
reply
2 -
Deshapran (community development block) -
wikt:cent.Decadal ,
wikt:peasants.Following
3 -
Design Web Format -
wikt:a .dwf ,
wikt:to .zip ,
wikt:with .NET : software jargon.
Ira Leviton (
talk ) 23:06, 17 February 2020 (UTC)
reply
1 -
Designbox -
wikt:supports .NET : software jargon.
Ira Leviton (
talk ) 23:06, 17 February 2020 (UTC)
reply
7 -
Desk accessory -
wikt:DOS .EXE ,
wikt:with .ACC ,
wikt:than .APP ,
wikt:Each .ACC ,
wikt:the .ACC ,
wikt:more .ACC ,
wikt:usually .ACX : software jargon.
Ira Leviton (
talk ) 23:06, 17 February 2020 (UTC)
reply
7 -
Desktop (word processor) -
wikt:sequential .Q : software jargon.
Ira Leviton (
talk ) 23:06, 17 February 2020 (UTC)
reply
1 -
DesktopX -
wikt:as .desktop : software jargon.
Ira Leviton (
talk ) 23:06, 17 February 2020 (UTC)
reply
3 -
Desulfobacteraceae - (probably OK:
wikt:ɥm ,
wikt:ɥm ,
wikt:ɥm ): Replaced with μ as instructed in the last bullet at the top of the page and according to
MOS:UNITSYMBOLS .
Ira Leviton (
talk ) 23:06, 17 February 2020 (UTC)
reply
1 -
Detroit (band) -
wikt:eventually .38 : part of a band name.
Ira Leviton (
talk ) 23:06, 17 February 2020 (UTC)
reply
1 -
Detroit Tigers award winners and league leaders -
wikt:and .461 : slugging average.
Ira Leviton (
talk ) 23:06, 17 February 2020 (UTC)
reply
3 -
DevPartner -
wikt:and .NET ,
wikt:and .NET ,
wikt:both .NET : software jargon.
Ira Leviton (
talk ) 02:23, 18 February 2020 (UTC)
reply
3 -
Devan Dubnyk -
wikt:and .921 ,
wikt:a .934 ,
wikt:a .920 : save percentages.
Ira Leviton (
talk ) 02:23, 18 February 2020 (UTC)
reply
4 -
Developmental language disorder -
wikt:you ,
wikt:you ,
wikt:you : in a quotation.
Ira Leviton (
talk ) 02:23, 18 February 2020 (UTC)
reply
2 -
Device driver -
wikt:Windows .sys ,
wikt:Linux .ko : software jargon.
Ira Leviton (
talk ) 02:23, 18 February 2020 (UTC)
reply
3 -
Devil May Cry: The Animated Series -
wikt:how's : inadvertent detection of "show's".
Ira Leviton (
talk ) 02:23, 18 February 2020 (UTC)
reply
2 -
Devils–Flyers rivalry -
wikt:under .500 : winning percentage.
Ira Leviton (
talk ) 02:23, 18 February 2020 (UTC)
reply
1 -
Devin Vassell -
wikt:a .419 : shooting percentage.
Ira Leviton (
talk ) 02:23, 18 February 2020 (UTC)
reply
1 -
Dewayne Dedmon -
wikt:a .551 : shooting percentage.
Ira Leviton (
talk ) 02:23, 18 February 2020 (UTC)
reply
1 -
Dexter Kernich-Drew -
wikt:a .433 : shooting percentage.
Ira Leviton (
talk ) 22:06, 18 February 2020 (UTC)
reply
8 -
Dhana yoga -
wikt:trikonas ,
wikt:trikonas ,
wikt:drekkena ,
wikt:trikonas ,
wikt:papagrahas (probably OK:
wikt:triksthana ,
wikt:trikonabhava ,
wikt:drekkenas ): yoga terms. Probably not English, but I'm not sure of the language so I can't tag them properly.
Ira Leviton (
talk ) 22:06, 18 February 2020 (UTC)
reply
2 -
Dialog Control Language - wikt:Studio .NET, wikt:the .NET: software jargon.
Ira Leviton (
talk ) 18:34, 19 February 2020 (UTC)
reply
1 -
Diana Mitford -
wikt:he's : inadvertent detection of part of another word.
Ira Leviton (
talk ) 18:34, 19 February 2020 (UTC)
reply
1 -
Dicastery for Communication - (probably OK:
wikt:dicastry ): corrected to dicastery.
Ira Leviton (
talk ) 18:34, 19 February 2020 (UTC)
reply
1 -
Dick Bertrand -
wikt:than .638 : winning percentage.
Ira Leviton (
talk ) 21:13, 19 February 2020 (UTC)
reply
9 -
Dick Billings -
wikt:a .305 ,
wikt:high .992 ,
wikt:a .254 ,
wikt:to .179 ,
wikt:a .227 ,
wikt:of .281 ,
wikt:a .984 ,
wikt:a .966 ,
wikt:a .906 : baseball statistics.
Ira Leviton (
talk ) 21:13, 19 February 2020 (UTC)
reply
1 -
Dick Davey -
wikt:of .581 : winning percentage.
Ira Leviton (
talk ) 21:13, 19 February 2020 (UTC)
reply
2 -
Dick Drott -
wikt:Colt .45s ,
wikt:Colt .45s : team name.
Ira Leviton (
talk ) 21:13, 19 February 2020 (UTC)
reply
1 -
Dick Gould -
wikt:a .840 : winning percentage.
Ira Leviton (
talk ) 21:13, 19 February 2020 (UTC)
reply
25 -
Dick Greco (baseball) -
wikt:hit .300 ,
wikt:hitting .332 ,
wikt:a .626 ,
wikt:hit .313 ,
wikt:batted .333 ,
wikt:a .552 ,
wikt:hit .330 ,
wikt:a .604 ,
wikt:hit .361 ,
wikt:a .644 ,
wikt:batted .312 ,
wikt:a .618 ,
wikt:hitting .298 ,
wikt:a .499 ,
wikt:hit .258 ,
wikt:and .403 ,
wikt:hitting .305 ,
wikt:a .615 ,
wikt:hit .305 ,
wikt:hit .356 ,
wikt:a .685 ,
wikt:hit .364 ,
wikt:a .656 ,
wikt:hitting .367 ,
wikt:around .328 : baseball statistics.
Ira Leviton (
talk ) 21:13, 19 February 2020 (UTC)
reply
1 -
Dick Maloney (American football) -
wikt:His .534 : winning percentage.
2 -
Dick Ruthven -
wikt:a .500 : winning percentage.
Ira Leviton (
talk ) 21:13, 19 February 2020 (UTC)
reply
5 -
Dick Siebert -
wikt:a .282 ,
wikt:was .332 ,
wikt:was .379 ,
wikt:a .990 ,
wikt:a .676 : baseball statistics.
Ira Leviton (
talk ) 21:13, 19 February 2020 (UTC)
reply
1 -
Dick Stigman -
wikt:a .500 : winning percentage.
Ira Leviton (
talk ) 21:13, 19 February 2020 (UTC)
reply
8 -
Dick Williams -
wikt:of .260 ,
wikt:Colt .45s ,
wikt:low .159 ,
wikt:than .500 ,
wikt:below .500 ,
wikt:below .500 ,
wikt:reached .500 : baseball statistics, team name.
Ira Leviton (
talk ) 21:13, 19 February 2020 (UTC)
reply
2 -
Diet-induced obesity model - (probably OK:
wikt:lipoprotien ,
wikt:signallingpathways ): corrected to lipoprotein and signalling pathways.
Ira Leviton (
talk ) 22:48, 19 February 2020 (UTC)
reply
1 -
Difflugia -
wikt:biogeonic : a legit word.
Ira Leviton (
talk ) 22:48, 19 February 2020 (UTC)
reply
6 -
Digistar -
wikt:and .sf ,
wikt:while .sf ,
wikt:Both .vl ,
wikt:and .sf ,
wikt:and .sfa ,
wikt:format .afa : software jargon.
Ira Leviton (
talk )
1 -
Digital Equipment Corporation -
wikt:ubiquitous .com : the famous internet domain suffix.
Ira Leviton (
talk ) 22:48, 19 February 2020 (UTC)
reply
4 -
Digital Item -
wikt:extension .m21 ,
wikt:or .mp21 : software jargon.
Ira Leviton (
talk ) 22:48, 19 February 2020 (UTC)
reply
2 -
Digital tachograph -
wikt:VO(EWG ,
wikt:a .ddd : software jargon.
Ira Leviton (
talk ) 22:48, 19 February 2020 (UTC)
reply
3 -
Digital waveguide synthesis -
wikt:using .VxD ,
wikt:not .WDM ,
wikt:a .VxD : software jargon.
Ira Leviton (
talk ) 22:48, 19 February 2020 (UTC)
reply
1 -
Dino Esposito -
wikt:several .NET : software jargon.
Ira Leviton (
talk ) 22:14, 20 February 2020 (UTC)
reply
7 -
Dion James -
wikt:batted .295 ,
wikt:hit .312 ,
wikt:hitting .332 ,
wikt:a .288 ,
wikt:a .364 ,
wikt:and .392 ,
wikt:a .987 : baseball statistics.
Ira Leviton (
talk ) 22:14, 20 February 2020 (UTC)
reply
1 -
Dipjan English High school - (probably OK:
wikt:chamlagain ): capitalized; it's a surname.
Ira Leviton (
talk ) 22:43, 20 February 2020 (UTC)
reply
3 -
Direct Access Archive -
wikt:the .daa ,
wikt:the .iso : software suffixes.
Ira Leviton (
talk ) 22:43, 20 February 2020 (UTC)
reply
3 -
Direct inward dial -
wikt:as .tif ,
wikt:or .pdf : software suffixes.
Ira Leviton (
talk ) 22:43, 20 February 2020 (UTC)
reply
2 -
DirectShow -
wikt:Microsoft .NET ,
wikt:how's : software jargon and an inadvertent detection of "show's."
Ira Leviton (
talk ) 22:43, 20 February 2020 (UTC)
reply
2 -
DirectSkin -
wikt:the .NET ,
wikt:creating .NET : software jargon.
Ira Leviton (
talk ) 22:43, 20 February 2020 (UTC)
reply
5 -
DirectX -
wikt:Microsoft .NET ,
wikt:within .NET ,
wikt:the .NET ,
wikt:the .NET ,
wikt:for .NET : software jargon.
Ira Leviton (
talk ) 22:43, 20 February 2020 (UTC)
reply
2 -
Dirt (TV series) -
wikt:how's : inadvertent detection of "show's".
Ira Leviton (
talk ) 22:43, 20 February 2020 (UTC)
reply
2 -
Dirt Track Racing: Sprint Cars -
wikt:the .DE2 : software file suffix.
Ira Leviton (
talk ) 22:43, 20 February 2020 (UTC)
reply
1 -
Disc2Phone -
wikt:and .NET : software jargon.
Ira Leviton (
talk ) 02:17, 21 February 2020 (UTC)
reply
1 -
DiscJuggler -
wikt:a .cdi : software file suffix.
Ira Leviton (
talk ) 02:17, 21 February 2020 (UTC)
reply
2 -
Disciples III: Renaissance -
wikt:by .dat ,
wikt:uses .dat : software file suffix.
Ira Leviton (
talk ) 02:17, 21 February 2020 (UTC)
reply
3 -
Disembowelment (band) -
wikt:d.USK ,
wikt:d.USK ,
wikt:d.USK : the name of a band.
Ira Leviton (
talk ) 02:17, 21 February 2020 (UTC)
reply
1 -
Disk Utility -
wikt:to .dmg : software file suffix.
Ira Leviton (
talk ) 02:17, 21 February 2020 (UTC)
reply
7 -
DiskImageMounter -
wikt:open .img ,
wikt:and .dart ,
wikt:dmgpart : software jargon.
Ira Leviton (
talk ) 02:17, 21 February 2020 (UTC)
reply
13 -
Display Data Channel -
wikt:monitor .INF ,
wikt:I²C ,
wikt:I²C ,
wikt:I²C ,
wikt:I²C ,
wikt:I²C ,
wikt:I²C ,
wikt:I²C-based ,
wikt:I²C ,
wikt:I²C ,
wikt:I²C ,
wikt:I²C : software file suffix and technology jargon.
Ira Leviton (
talk ) 02:17, 21 February 2020 (UTC)
reply
1 -
Distributed denial-of-service attacks on root nameservers -
wikt:the .com : Correctly using the .com suffix.
Ira Leviton (
talk ) 02:17, 21 February 2020 (UTC)
reply
8 -
Divergence-from-randomness model -
wikt:obs,elite ,
wikt:poisson,all ,
wikt:elite(Kt ,
wikt:lambda(Kt ,
wikt:avgtf : math symbols and jargon.
Ira Leviton (
talk ) 17:20, 21 February 2020 (UTC)
reply
1 -
Dixie Beehives (2005–11) -
wikt:under .500 : winning percentage.
Ira Leviton (
talk ) 17:20, 21 February 2020 (UTC)
reply
5 -
Dmitry Burkov -
wikt:Russian .RU ,
wikt:and .РФ ,
wikt:TLD .RU ,
wikt:domains .RU ,
wikt:and .РФ : Internet domain suffixes.
Ira Leviton (
talk ) 17:20, 21 February 2020 (UTC)
reply
1 -
DnAnalytics -
wikt:for .NET : software jargon.
Ira Leviton (
talk ) 17:20, 21 February 2020 (UTC)
reply
1 -
Docsity -
wikt:including .doc file extension name/software jargon
Whisperjanes (
talk ) 02:45, 20 February 2020 (UTC)
reply
3 -
Docstoc -
wikt:as .docstoc ,
wikt:including .doc ,
wikt:and .ppt 1 = part of company name; 2, 3 = file extension names
Whisperjanes (
talk ) 02:45, 20 February 2020 (UTC)
reply
1 -
DocuWare -
wikt:on .NET software jargon
Whisperjanes (
talk ) 02:45, 20 February 2020 (UTC)
reply
1 -
Document! X -
wikt:other .NET software jargon
Whisperjanes (
talk ) 02:45, 20 February 2020 (UTC)
reply
2 -
Dodge Neon SRT-4 -
wikt:dynoed seems to be a car industry term. Not sure if it should be added to wiktionary or not
Whisperjanes (
talk ) 02:45, 20 February 2020 (UTC)
reply
5 -
Dodiya - (probably OK:
wikt:gautra ,
wikt:deepang ,
wikt:dodiyas ) unsure of language or if there is better spelling available. Deepang capitalized because it's a proper name
Whisperjanes (
talk ) 02:45, 20 February 2020 (UTC)
reply
3 -
Dolf Luque -
wikt:a .227 ,
wikt:a .355 ,
wikt:with .599 : baseball statistics.
Ira Leviton (
talk ) 22:42, 22 February 2020 (UTC)
reply
2 -
Dolores Wilson (baseball) -
wikt:of .217 ,
wikt:a .864 : baseball statistics.
Ira Leviton (
talk ) 22:42, 22 February 2020 (UTC)
reply
2 -
Dolphin Cove (SeaWorld) -
wikt:it's : inadvertent detection of "exhibit's".
Ira Leviton (
talk ) 22:42, 22 February 2020 (UTC)
reply
4 -
Dolphins–Jets rivalry -
wikt:above .500 : winning percentage.
Ira Leviton (
talk ) 22:42, 22 February 2020 (UTC)
reply
7 -
Domain name registrar -
wikt:plus .us ,
wikt:included .com ,
wikt:and .us : domain suffixes.
Ira Leviton (
talk ) 21:47, 21 February 2020 (UTC)
reply
3 -
Domain name registry -
wikt:the .com ,
wikt:are .us ,
wikt:and .uk : domain suffixes.
Ira Leviton (
talk ) 21:47, 21 February 2020 (UTC)
reply
5 -
Domain privacy -
wikt:with .ca ,
wikt:of .us ,
wikt:and .ch ,
wikt:for .ch ,
wikt:and .li : domain suffixes.
Ira Leviton (
talk ) 21:47, 21 February 2020 (UTC)
reply
7 -
Domain registration -
wikt:plus .us : domain suffix.
Ira Leviton (
talk ) 21:47, 21 February 2020 (UTC)
reply
9 -
Domainz -
wikt:original .nz ,
wikt:the .nz ,
wikt:issued .nz ,
wikt:the .nz ,
wikt:the .nz ,
wikt:the .nz ,
wikt:the .nz ,
wikt:the .nz ,
wikt:the .nz : domain suffixes.
Ira Leviton (
talk ) 21:47, 21 February 2020 (UTC)
reply
1 -
Domingo Germán -
wikt:at .818 : winning percentage.
Ira Leviton (
talk ) 21:47, 21 February 2020 (UTC)
reply
4 -
Dominik Hašek -
wikt:at .940 ,
wikt:a .930 ,
wikt:and .937 ,
wikt:it's : save percentage, inadvertent detecton of "Detroit's".
Ira Leviton (
talk ) 21:47, 21 February 2020 (UTC)
reply
3 -
Don "Red" Barry -
wikt:Colt .45 ,
wikt:here's : team name, part of a movie title.
Ira Leviton (
talk ) 21:47, 21 February 2020 (UTC)
reply
4 -
Don Arlich -
wikt:Colt .45s ,
wikt:Colt .45s ,
wikt:Colt .45s ,
wikt:Colt .45s : team name.
Ira Leviton (
talk ) 21:47, 21 February 2020 (UTC)
reply
2 -
Don Bradey -
wikt:Colt .45s ,
wikt:Colt .45s : baseball team name.
Ira Leviton (
talk ) 04:01, 22 February 2020 (UTC)
reply
1 -
Don Cahoon -
wikt:around .500 : winning percentage.
Ira Leviton (
talk ) 04:01, 22 February 2020 (UTC)
reply
1 -
Don Chastain -
wikt:Colt .45 : the name of a TV series. 04:01, 22 February 2020 (UTC)
1 -
Don Corbett -
wikt:s .729 : winning percentage following a possessive case.
Ira Leviton (
talk ) 04:01, 22 February 2020 (UTC)
reply
4 -
Don Ferrarese -
wikt:was .156 ,
wikt:a .036 ,
wikt:a .952 ,
wikt:Colt .45 : baseball statistics, team name.
Ira Leviton (
talk ) 04:01, 22 February 2020 (UTC)
reply
1 -
Don Haggerty -
wikt:Colt .45 : gun name.
Ira Leviton (
talk ) 04:01, 22 February 2020 (UTC)
reply
2 -
Don Heffner -
wikt:batted .241 ,
wikt:the .500 : baseball statistics.
Ira Leviton (
talk ) 04:01, 22 February 2020 (UTC)
reply
12 -
Don Hoak -
wikt:batted .215 ,
wikt:to .293 ,
wikt:over .400 ,
wikt:batted .261 ,
wikt:batted .282 ,
wikt:high .298 ,
wikt:to .241 ,
wikt:batted .231 ,
wikt:a .265 ,
wikt:and .396 ,
wikt:a .959 ,
wikt:batted .231 : baseball statistics.
Ira Leviton (
talk ) 04:01, 22 February 2020 (UTC)
reply
6 -
Don Hurst -
wikt:batted .339 ,
wikt:batted .199 ,
wikt:a .298 ,
wikt:a .375 ,
wikt:and .478 ,
wikt:a .987 : baseball statistics.
Ira Leviton (
talk ) 04:01, 22 February 2020 (UTC)
reply
10 -
Don Kessinger -
wikt:Chicago(land ,
wikt:a .201 ,
wikt:a .304 ,
wikt:high .274 ,
wikt:a .273 ,
wikt:a .266 ,
wikt:a .320 ,
wikt:a .252 ,
wikt:of .314 ,
wikt:a .965 : baseball statistics.
Ira Leviton (
talk ) 04:01, 22 February 2020 (UTC)
reply
27 -
Don Mattingly -
wikt:batted .463 ,
wikt:bat .500 ,
wikt:his .349 ,
wikt:than .340 ,
wikt:batted .358 ,
wikt:and .316 ,
wikt:hitting .325 ,
wikt:hit .283 ,
wikt:of .339 ,
wikt:by .002 ,
wikt:a .343 ,
wikt:a .340 ,
wikt:batted .324 ,
wikt:batted .354 ,
wikt:a .573 ,
wikt:batted .352 ,
wikt:a .327 ,
wikt:a .311 ,
wikt:to .303 ,
wikt:a .256 ,
wikt:averaged .290 ,
wikt:a .304 ,
wikt:over .300 ,
wikt:batted .417 ,
wikt:of .551 ,
wikt:a .307 ,
wikt:a .358 : baseball statistics.
Ira Leviton (
talk ) 04:21, 22 February 2020 (UTC)
reply
3 -
Don Mossi -
wikt:below .500 ,
wikt:below .500 ,
wikt:of .990 : baseball statistics.
Ira Leviton (
talk ) 04:21, 22 February 2020 (UTC)
reply
4 -
Don Mueller -
wikt:over .300 ,
wikt:hit .389 ,
wikt:of .296 ,
wikt:of .712 : baseball statistics.
Ira Leviton (
talk ) 04:21, 22 February 2020 (UTC)
reply
1 -
Don Nachbaur -
wikt:a .592 : winning percentage.
Ira Leviton (
talk ) 04:21, 22 February 2020 (UTC)
reply
2 -
Don Nottebart -
wikt:Colt .45s ,
wikt:Colt .45s ; team name.
Ira Leviton (
talk ) 04:21, 22 February 2020 (UTC)
reply
1 -
Don Osborn -
wikt:a .626winning percentage.
Ira Leviton (
talk ) 04:21, 22 February 2020 (UTC)
reply
1 -
Don Peden -
wikt:of .711 : winning percentage.
Ira Leviton (
talk ) 04:21, 22 February 2020 (UTC)
reply
1 -
Don Schwall -
wikt:under .500 : winning percentage.
Ira Leviton (
talk ) 04:21, 22 February 2020 (UTC)
reply
1 -
Don Syme -
wikt:the .NET : software jargon.
Ira Leviton (
talk ) 04:21, 22 February 2020 (UTC)
reply
1 -
Don Wilson (baseball) -
wikt:finished .500 : winning percentage.
Ira Leviton (
talk ) 04:21, 22 February 2020 (UTC)
reply
1 -
Don't Look at Me (Desperate Housewives) -
wikt:how's : inadvertent detection of "show's".
1 -
Donald Russell (American football) -
wikt:of .661 : winning percentage.
Ira Leviton (
talk ) 02:18, 23 February 2020 (UTC)
reply
1 -
Donatas Zavackas -
wikt:His .807
1 -
Donnie Steele -
wikt:album .5 : part of an album name.
2 -
Doorstep (company) -
wikt:the .no ,
wikt:of .com : software domain suffixes.
Ira Leviton (
talk ) 03:01, 23 February 2020 (UTC)
reply
1 -
Dorota Nvotová -
wikt:newspaper .týždeň : the name of a Czech newspaper.
Ira Leviton (
talk ) 16:10, 23 February 2020 (UTC)
reply
` 1 -
Dorsal nexus (probably OK:
wikt:parahipocampal ): corrected to parahippocampal.
Ira Leviton (
talk ) 16:10, 23 February 2020 (UTC)
reply
1 -
Dot-S -
wikt:as .S : showing a style.
Ira Leviton (
talk ) 16:10, 23 February 2020 (UTC)
reply
1 -
Dot. -
wikt:the .com : correctly written.
Ira Leviton (
talk ) 16:10, 23 February 2020 (UTC)
reply
15 -
DotCooperation -
wikt:namespace .coop ,
wikt:the .coop ,
wikt:the .coop ,
wikt:The .coop ,
wikt:The .coop ,
wikt:the .coop ,
wikt:the .coop ,
wikt:the .coop ,
wikt:provides .coop ,
wikt:The .coop ,
wikt:all .coop ,
wikt:the .coop ,
wikt:the .coop ,
wikt:the .coop ,
wikt:Marque .coop : all software jargon.
Ira Leviton (
talk ) 16:10, 23 February 2020 (UTC)
reply
19 -
DotGNU -
wikt:s .NET ,
wikt:Basic .NET ,
wikt:the .NET ,
wikt:Portable .NET ,
wikt:any .NET ,
wikt:Like .NET ,
wikt:Portable .NET ,
wikt:Portable .NET ,
wikt:the .NET ,
wikt:the .NET ,
wikt:released .NET ,
wikt:the .NET ,
wikt:the .NET ,
wikt:official .NET ,
wikt:on .NET ,
wikt:regarding .NET (probably OK:
wikt:libJIT ,
wikt:libJIT ,
wikt:libJIT ): all software jargon.
Ira Leviton (
talk ) 16:10, 23 February 2020 (UTC)
reply
1 -
DotGears -
wikt:as .GEARS : deliberately done to show stylization.
Ira Leviton (
talk ) 16:10, 23 February 2020 (UTC)
reply
2 -
Dotfuscator -
wikt:on .NET ,
wikt:the .NET : software jargon.
Ira Leviton (
talk ) 16:10, 23 February 2020 (UTC)
reply
1 -
Dotsoul -
wikt:paste .rwx : software suffix.
Ira Leviton (
talk ) 16:10, 23 February 2020 (UTC)
reply
1 -
Dotted and dotless I -
wikt:The .NET : software jargon.
Ira Leviton (
talk ) 16:10, 23 February 2020 (UTC)
reply
1 -
Dr. Ben/Nick -
wikt:how's : inadvertent detection of "show's".
Ira Leviton (
talk ) 01:09, 24 February 2020 (UTC)
reply
1 -
Drain -
wikt:the .hack : software jargon.
1 -
Drawing Express -
wikt:a .EXP : software file extension suffix.
Ira Leviton (
talk ) 20:39, 24 February 2020 (UTC)
reply
2 -
Drawn File -
wikt:is .drawn ,
wikt:a .drw : software file extension suffixes.
Ira Leviton (
talk ) 20:39, 24 February 2020 (UTC)
reply
1 -
Dream Market -
wikt:an .onion : a software suffix.
Ira Leviton (
talk ) 20:39, 24 February 2020 (UTC)
reply
1 -
Drillia lignaria - (probably OK:
wikt:whor ): corrected to whorl.
Ira Leviton (
talk ) 20:39, 24 February 2020 (UTC)
reply
2 -
Drive Image (software) -
wikt:was .gho ,
wikt:is .v2i : software jargon.
Ira Leviton (
talk ) 20:39, 24 February 2020 (UTC)
reply
2 -
Drosophila suzukii -
wikt:it's : inadvertent detection of "fruit's".
Ira Leviton (
talk ) 20:39, 24 February 2020 (UTC)
reply
1 -
Drum and lyre corps -
wikt:cymbals .Sometimes
1 -
Duma Ndlovu -
wikt:how's : inadvertent detection of "show's".
3 -
Duncan MacGregor Crerar -
wikt:dowerets : in poetry.
Ira Leviton (
talk )
1 -
Dundas Data Visualization -
wikt:and .NET : software suffix.
Ira Leviton (
talk ) 18:35, 25 February 2020 (UTC)
reply
1 -
Dungeon Siege II -
wikt:the .ini : software file suffix.
Ira Leviton (
talk ) 18:35, 25 February 2020 (UTC)
reply
2 -
Duplicati -
wikt:either .NET : software suffix.
Ira Leviton (
talk ) 18:35, 25 February 2020 (UTC)
reply
2 -
Duplone -
wikt:duplones : plural of the subject of the page, a Middle Age coin.
Ira Leviton (
talk ) 18:35, 25 February 2020 (UTC)
reply
1 -
Durgapur Barrage - (probably OK:
wikt:warer ): corrected to water.
Ira Leviton (
talk ) 18:35, 25 February 2020 (UTC)
reply
5 -
Dutch guilder -
wikt:rooi(tj : written deliberately to show an alternative Dutch spelling.
Ira Leviton (
talk ) 22:59, 25 February 2020 (UTC)
reply
2 -
Duttaphrynus hololius - (probably OK:
wikt:hololus ): corrected to hololius.
Ira Leviton (
talk ) 22:59, 25 February 2020 (UTC)
reply
8 -
Dynamic Language Runtime -
wikt:the .NET ,
wikt:Basic .NET ,
wikt:shipped .NET ,
wikt:of .NET ,
wikt:the .NET ,
wikt:the .NET ,
wikt:a .NET ,
wikt:the .NET : software jargon.
Ira Leviton (
talk ) 22:59, 25 February 2020 (UTC)
reply
1 -
Dynamic debugging technique -
wikt:the .EXE : a software suffix.
Ira Leviton (
talk ) 22:59, 25 February 2020 (UTC)
reply
1 -
Dynamic syntax tree -
wikt:from .NET : software suffix.
Ira Leviton (
talk ) 22:59, 25 February 2020 (UTC)
reply
6 -
Dynamic-link library -
wikt:a .DRV ,
wikt:with .EXE ,
wikt:promotes .NET ,
wikt:the .lib ,
wikt:a .DEF ,
wikt:the .exe : software suffixes.
Ira Leviton (
talk ) 22:59, 25 February 2020 (UTC)
reply
3 -
Dynamsoft -
wikt:Dynamic .NET ,
wikt:A .NET ,
wikt:and .NET : software jargon.
Ira Leviton (
talk ) 22:59, 25 February 2020 (UTC)
reply
1 -
Défi mini-putt -
wikt:tounements : corrected to tournaments.
Ira Leviton (
talk ) 22:59, 25 February 2020 (UTC)
reply
19 -
Dōka -
wikt:you ,
wikt:your ,
wikt:you ,
wikt:you ,
wikt:you ,
wikt:you ,
wikt:your ,
wikt:you ,
wikt:you ,
wikt:you ,
wikt:you ,
wikt:you ,
wikt:you ,
wikt:you ,
wikt:you ,
wikt:you ,
wikt:you ,
wikt:you ,
wikt:your : all in translations.
Ira Leviton (
talk ) 22:59, 25 February 2020 (UTC)
reply
TS+COMMA+
3 -
D-Man-alpha-(1-3)-D-Glc-beta-(1-4)-D-Glc-alpha-1-diphosphoundecaprenol 2-beta-glucuronyltransferase -
wikt:ditrans,octacis ,
wikt:ditrans,octacis ,
wikt:ditrans,octacis - chemistry notation
Strickesel (
talk )
1 -
DTDP-4-amino-4,6-dideoxy-D-glucose transaminase -
wikt:diphospho-4-amino-4,6-dideoxyglucose - chemistry notation
Strickesel (
talk )
1 -
Dabestan-e Mazaheb -
wikt:your - in a quote, fixed quotation marks
Strickesel (
talk )
1 -
Daisaku Ikeda -
wikt:人間主義の大世紀を―わが人生を飾れ - correct japanese, as far as I can tell
Strickesel (
talk )
1 -
Dan Halsted -
wikt:here's - part of a title
Strickesel (
talk )
1 -
Dan Linfoot - (probably OK:
wikt:debút ) - changed to debut
Strickesel (
talk )
2 -
Daniel Steven Crafts -
wikt:your ,
wikt:your - both part of a title
Strickesel (
talk )
1 -
Danijela Stefanović -
wikt:istoriji - part of a book title, serbian I think
Strickesel (
talk )
1 -
Danny Boome -
wikt:your ,
wikt:your - in a quote, fixed quotation marks
Strickesel (
talk )
1 -
Danny Cannon -
wikt:how's - show's
Strickesel (
talk )
1 -
Danny Milosevic -
wikt:you - "pay as you play contract", put it into quotation marks
Strickesel (
talk )
1 -
Danube Vilayet -
wikt:Dunavska(ta - part of a translation
Strickesel (
talk )
1 -
Darren Wyse -
wikt:how's - show's
Strickesel (
talk )
3 -
Data & Analysis Center for Software -
wikt:you ,
wikt:your (probably OK:
wikt:I've ) - all of these are in semi-quotes, put them in quotation marks
Strickesel (
talk )
1 -
Dave Holmes (sportscaster) -
wikt:how's - show's
Strickesel (
talk )
1 -
Davenport Neck - (probably OK:
wikt:brotherinlaw ) - changed to brother-in-law
Strickesel (
talk )
1 -
David E. Cooper -
wikt:he's - Nietzsche's
Strickesel (
talk )
1 -
David Nunn Fisher -
wikt:he's - Blanche's
Strickesel (
talk )
1 -
David Westhead -
wikt:he's - part of a title
Strickesel (
talk )
1 -
Davidson Garrett -
wikt:how's - show's
Strickesel (
talk )
1 -
Dead Cities, Red Seas & Lost Ghosts -
wikt:DeadCities,RedSeas - stylized version without spaces
Strickesel (
talk )
4 -
Death of the Doctor -
wikt:artron ,
wikt:artron ,
wikt:artron ,
wikt:artron - term from this universe
Strickesel (
talk )
1 -
Debjani Chatterjee -
wikt:you - part of a title
Strickesel (
talk )
3 -
Decaprenyl-phosphate phosphoribosyltransferase -
wikt:trans,octacis ,
wikt:trans,octacis ,
wikt:trans,octacis - chemical notation
Strickesel (
talk )
3 -
Decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase -
wikt:trans,octacis ,
wikt:trans,octacis ,
wikt:trans,octacis - chemical notation
Strickesel (
talk )
1 -
Dedekind sum -
wikt:ad,bd ,
wikt:ad,bd - mathematical notation
Strickesel (
talk )
1 -
Dehydroalanine -
wikt:derivative—3,5-dihydro-5-methyldiene-4H-imidazol-4-one—that - removed derivative and that, rest is a chemical notation
Strickesel (
talk )
1 -
Deivamagal -
wikt:how's - show's
Strickesel (
talk )
2 -
Delhi in a Day -
wikt:here's ,
wikt:you - in a quote, put in quotation marks
Strickesel (
talk )
1 -
Delta11-fatty-acid desaturase -
wikt:CoA,hydrogen - chemical notation
Strickesel (
talk )
3 -
Delta12-fatty-acid desaturase -
wikt:CoA,hydrogen ,
wikt:Delta12(omega6 - chemical notation
Strickesel (
talk )
1 -
Democrat Party (Thailand) -
wikt:it's - Abhitit's
Strickesel (
talk )
1 -
Demy (singer) - (probably OK:
wikt:fanky ) - changed to funky
Strickesel (
talk )
1 -
Denotational semantics -
wikt:E1,E2 - mathematical notation
Strickesel (
talk )
1 -
Deoxyhypusine monooxygenase -
wikt:deoxyhypusine,hydrogen - chemical notation
Strickesel (
talk )
1 -
Derek Pell -
wikt:decenterization - a real word, I think
Strickesel (
talk )
2 -
Derrygonnelly Harps GAC -
wikt:gConaile - maybe OK, but should be checked by someone knowledgable in Irish language
1 -
Desulfobacter hydrogenophilus -
wikt:Cis-9,10-methylenehexadecanoic - chemical notation
4 -
Desymmetrization -
wikt:PhCH(OH ,
wikt:cis-3,5-diacetoxycyclopentene (probably OK:
wikt:desymmetrisations ,
wikt:hydrobenzoin ) -all OK, chemical notations and a plural
2 -
Dhanga, Bihar -
wikt:panchait ,
wikt:hatbarya - don't know what I should change these words to
Strickesel (
talk )
5 -
Dhobi -
wikt:hathwal ,
wikt:hathwal ,
wikt:ataks ,
wikt:ataks ,
wikt:hathwal - don't think those are typos, but not sure
Strickesel (
talk )
3 -
Diadenosine hexaphosphate hydrolase (AMP-forming) -
wikt:P1,P6 ,
wikt:P1,P6 ,
wikt:P1,P5 - chemical notations
Strickesel (
talk )
4 -
Diadenosine hexaphosphate hydrolase (ATP-forming) -
wikt:P1,P6 ,
wikt:P1,P6 ,
wikt:P1,P5 ,
wikt:P1,P4 - chemical notations
Strickesel (
talk )
2 -
Diamine transaminase -
wikt:alpha,omega ,
wikt:alpha,omega - chemical notations, I think
Strickesel (
talk )
2 -
Dick O'Neill -
wikt:Mysteries,Three , - fixed previous -
Jkgree (
talk ) 20:59, 25 February 2020 (UTC) , but left the following:
wikt:he's - this one's part of a title
Strickesel (
talk )
reply
1 -
Diethylthiambutene -
wikt:N-Diethyl-1-methyl-3,3-di-2-thienylallylamine - chemical notation
Strickesel (
talk )
5 -
Dimethylhistidine N-methyltransferase -
wikt:Nalpha,Nalpha ,
wikt:Nalpha,Nalpha ,
wikt:Nalpha,Nalpha ,
wikt:Nalpha,Nalpha ,
wikt:Nalpha,Nalpha - chemical notation
Strickesel (
talk )
1 -
Dimethylmalate dehydrogenase -
wikt:beta,beta - chemical notation
Strickesel (
talk )
1 -
Dimethylthiambutene -
wikt:N-Dimethyl-1-methyl-3,3-di-2-thienylallylamine - chemical notation
Strickesel (
talk )
1 -
Disappearance of Royal Marine Alan Addis -
wikt:it's - unit's
Strickesel (
talk )
1 -
Disney Parks Christmas Day Parade -
wikt:how's - show's
JaAlDo (
talk )
2 -
Ditrans,polycis-polyprenyl diphosphate synthase ((2E,6E)-farnesyl diphosphate specific) -
wikt:Ditrans,polycis ,
wikt:ditrans,polycis - chemical notations
JaAlDo (
talk )
3 -
Donemana -
wikt:Curry,Irish , amana[gh, amana[gh: written deliberately to show alternative Gaelic spelling.
Ira Leviton (
talk ) 19:13, 26 February 2020 (UTC)
reply
1 -
Donna Feldman -
wikt:how's : inadvertent detection of "show's".
Ira Leviton (
talk ) 19:13, 26 February 2020 (UTC)
reply
1 -
Donna Martin -
wikt:how's : inadvertent detection of "show's".
Ira Leviton (
talk ) 19:13, 26 February 2020 (UTC)
reply
6 -
Drobnjaci -
wikt:starinci ,
wikt:katuns specific terminology related to the subject
JaAlDo (
talk ) 15:20, 5 March 2020 (UTC)
reply
1 -
Durio kutejensis - (probably OK:
wikt:substorey ) - not sure if okay
Strickesel (
talk )
TS+BRACKET+
6 -
D electron count - Ar]4s, Ar]4s, Ar]4s, Ar]4s,
wikt:hexamminecobalt(III ,
wikt:nickel(II - chemical notations
Strickesel (
talk )
4 -
D-DIA -
wikt:dm(hkl ,
wikt:dp(hkl ,
wikt:GR(HKL ,
wikt:gasketing - chemical notations, and the adjective for 'gasket' it seems
Strickesel (
talk )
4 -
D-alanine—poly(phosphoribitol) ligase -
wikt:poly(ribitol ,
wikt:poly(ribitol ,
wikt:poly(ribitol ,
wikt:poly(ribitol - chemical notations
Strickesel (
talk )
1 -
D-arabinose 1-dehydrogenase -
wikt:arabinose(fucose - chemical notations
Strickesel (
talk )
5 -
D-aspartate ligase -
wikt:Ac(oyl ,
wikt:Ac(oyl ,
wikt:Mur2Ac(oyl ,
wikt:Mur2Ac(oyl ,
wikt:Mur2Ac(oyl - chemical notations
Strickesel (
talk )
2 -
D-bifunctional protein deficiency -
wikt:pristinic ,
wikt:pristinic - might be okay
Strickesel (
talk )
1 -
D-xylulose reductase -
wikt:polyol(DPN - chemical notations
Strickesel (
talk )
2 -
D. Babu Paul -
wikt:omoyde ,
wikt:briro - the name of a book and an award, respectively
Strickesel (
talk )
2 -
DATP(dGTP)—DNA purinetransferase -
wikt:dATP(dGTP ,
wikt:dATP(dGTP - chemical notations
Strickesel (
talk )
1 -
DB locomotive classification -
wikt:sub)class - correct
Strickesel (
talk )
1 -
DBN1 -
wikt:tm1b(KOMP - chemical notations
Strickesel (
talk )
1 -
DBrn -
wikt:dB(rn - some kind of notation
Strickesel (
talk )
1 -
DCBLD2 -
wikt:tm1a(KOMP - chemical notations
Strickesel (
talk )
1 -
DCC1 -
wikt:tm1a(KOMP - chemical notations
Strickesel (
talk )
1 -
DCTN5 -
wikt:tm2a(KOMP - chemical notations
Strickesel (
talk )
1 -
DCVG -
wikt:copper(II - chemical notations
Strickesel (
talk )
1 -
DDX27 -
wikt:tm1a(KOMP - chemical notations
Strickesel (
talk )
1 -
DDX42 -
wikt:tm1b(EUCOMM - chemical notations
Strickesel (
talk )
1 -
DECserver - DECSERVER]DS5CFG - computational notations
Strickesel (
talk )
2 -
DFNB31 -
wikt:tm1a(EUCOMM ,
wikt:tm1a(EUCOMM - chemical notations
Strickesel (
talk )
1 -
DIP2A -
wikt:tm2b(KOMP - chemical notations
Strickesel (
talk )
1 -
DIP2B -
wikt:tm1a(EUCOMM - chemical notations
Strickesel (
talk )
1 -
DIPAMP -
wikt:anisyl(phenyl - chemical notations
Strickesel (
talk )
2 -
DJMax Portable 3 -
wikt:you ,
wikt:your - in song titles
Strickesel (
talk )
1 -
DLG3 -
wikt:tm1a(EUCOMM - chemical notations
Strickesel (
talk )
1 -
DMC1 (gene) -
wikt:Tid1(Rdh54 - chemical notations
Strickesel (
talk )
1 -
DNA (cytosine-5)-methyltransferase 3A -
wikt:tm1a(KOMP - chemical notations
Strickesel (
talk )
2 -
DNA ligase (NAD+) -
wikt:poly(deoxyribonucleotide ,
wikt:poly(deoxyribonucleotide - chemical notations
Strickesel (
talk )
3 -
DNA topoisomerase -
wikt:magnesium(II ,
wikt:magnesium(II ,
wikt:magnesium(II - chemical notations
Strickesel (
talk )
6 -
DNA-binding metallo-intercalators -
wikt:Ru(bpy ,
wikt:Ru(phen ,
wikt:Ru(bpy ,
wikt:Ru(bpy ,
wikt:Ru(bpy ,
wikt:Ru(phen - chemical notations
Strickesel (
talk )
1 -
DNA-deoxyinosine glycosylase -
wikt:DNA(hypoxanthine - chemical notations
Strickesel (
talk )
1 -
DNASE1L2 -
wikt:tm1(KOMP - chemical notations
Strickesel (
talk )
1 -
DNPEP -
wikt:tm1e(EUCOMM - chemical notations
Strickesel (
talk )
1 -
DOK1 -
wikt:p210(bcr - chemical notations
Strickesel (
talk )
1 -
DOK2 -
wikt:p210(bcr - chemical notations
Strickesel (
talk )
1 -
DPM1 -
wikt:tm1b(KOMP - chemical notations
Strickesel (
talk )
1 -
DUSP3 -
wikt:tm1a(KOMP - chemical notations
Strickesel (
talk )
1 -
DUSP5 -
wikt:tm1a(KOMP - chemical notations
Strickesel (
talk )
Dadakuada -
wikt:ijala - ok
Dagan languages -
wikt:obosa ,
wikt:kumbutu - ok
Damacharla Janardhana Rao - (not OK:
wikt:balneni - proper name Balineni)
3 -
Dan Ariely -
wikt:Dis)Honesty ,
wikt:Dis)Honesty - Title of his book.
1 -
Dan Hurlin -
wikt:No(thing - title of work
1 -
Dan Starkey (actor) -
wikt:Five(ish - name of a TV program. It should have been picked up in the title of a Wikipedia page
2 -
Dancing in the Dark (Howard Dietz and Arthur Schwartz song) - (probably OK:
wikt:I've ) - Title of an album
2 -
Daporijo -
wikt:yullo - Name of a festival
5 -
Dark Age of Camelot - probably OK:
wikt:mythrians ,
wikt:mythirians - creatures in the game
JaAlDo (
talk ) 21:26, 9 March 2020 (UTC)
reply
4 -
Darul Uloom Al-Madania -
wikt:eAlim ,
wikt:eAlim ,
wikt:eAlim - name of a course
4 -
DarkComet - Trojan[Backdoor - computer file name
JaAlDo (
talk ) 21:29, 9 March 2020 (UTC)
reply
2 -
Data validation -
wikt:substr(Middle_Name : software programming code.
Ira Leviton (
talk ) 02:41, 27 February 2020 (UTC)
reply
4 -
Database index -
wikt:reverse(email_address : software programming code.
Ira Leviton (
talk ) 02:41, 27 February 2020 (UTC)
reply
1 -
Dave Couse - Hyper[borea: the name of a band.
Ira Leviton (
talk ) 02:41, 27 February 2020 (UTC)
reply
1 -
Dave Hull -
wikt:Mis)Adventures : part of a title.
Ira Leviton (
talk ) 02:41, 27 February 2020 (UTC)
reply
2 -
David Blackburn (artist) - transform[ed: in a quotation.
Ira Leviton (
talk ) 02:36, 28 February 2020 (UTC)
reply
1 -
David C. Hilmers -
wikt:VMA(AW : United States Navy jargon.
Ira Leviton (
talk ) 02:36, 28 February 2020 (UTC)
reply
2 -
David Camorlinga Tagle - (probably OK:
wikt:linksSebastián ): corrected, the Sebastian was stray, they are two words.
Ira Leviton (
talk ) 02:36, 28 February 2020 (UTC)
reply
1 -
David Cardwell -
wikt:RE)BCO : undefined jargon. I couldn't fix it, so I put a clarify tag on it.
Ira Leviton (
talk ) 02:36, 28 February 2020 (UTC)
reply
1 -
David E. Davis -
wikt:let's : inadvertent detection of "Chevrolet's".
Ira Leviton (
talk ) 19:28, 28 February 2020 (UTC)
reply
1 -
David Harvey -
wikt:re)creation : written deliberately.
Ira Leviton (
talk ) 19:28, 28 February 2020 (UTC)
reply
1 -
David J. Schmidly -
wikt:un)Occupy : written deliberately.
Ira Leviton (
talk ) 19:28, 28 February 2020 (UTC)
reply
1 -
David Schramm (actor)
wikt:how's : inadvertent detection of "show's".
1 -
David Stone (military historian) - afford[ed: written deliberately to paraphrase a quotation.
Ira Leviton (
talk ) 19:28, 28 February 2020 (UTC)
reply
1 -
David Troughton -
wikt:Five(ish : a word in the title of a play.
Ira Leviton (
talk ) 19:28, 28 February 2020 (UTC)
reply
1 -
David Wills (writer) -
wikt:De)construct : a word in the title of a book.
Ira Leviton (
talk ) 19:28, 28 February 2020 (UTC)
reply
2 -
Day–Stout–Warren algorithm -
wikt:tree(root ,
wikt:compress(root : software coding.
Ira Leviton (
talk ) 16:59, 29 February 2020 (UTC)
reply
1 -
De Smet Jesuit High School -
wikt:it's : inadvertent detection of "Jesuit's".
1 -
De arte aleae - Lib[er: from a quotation.
Ira Leviton (
talk ) 18:23, 29 February 2020 (UTC)
reply
3 -
De'VIA -
wikt:Ame(rican ,
wikt:Lan(guage : both used to demonstrate a word root.
Ira Leviton (
talk ) 18:23, 29 February 2020 (UTC)
reply
1 -
Deacon process -
wikt:ruthenium(IV : chemistry notation.
Ira Leviton (
talk ) 19:41, 29 February 2020 (UTC)
reply
2 -
Dear God (XTC song) -
wikt:re)Production ,
wikt:re)Production : the name of an album.
Ira Leviton (
talk ) 19:41, 29 February 2020 (UTC)
reply
1 -
Deborah Watling -
wikt:Five(ish : a word in the title of a TV show.
Ira Leviton (
talk ) 19:41, 29 February 2020 (UTC)
reply
1 -
Debra Yepa-Pappan -
wikt:Dual(ing : a word in the title of an artwork.
Ira Leviton (
talk ) 19:41, 29 February 2020 (UTC)
reply
1 -
Debug new -
wikt:new(__FILE__ : software jargon.
Ira Leviton (
talk ) 19:41, 29 February 2020 (UTC)
reply
3 -
Decaborane -
wikt:decaborane(14 ,
wikt:decaborane(14 ,
wikt:Decaborane(14 : chemistry notation.
Ira Leviton (
talk ) 20:23, 29 February 2020 (UTC)
reply
7 -
Decamethylferrocene -
wikt:iron(II ,
wikt:iron(II ,
wikt:iron(II ,
wikt:iron(III ,
wikt:iron(IV : chemistry notation.
Ira Leviton (
talk ) 20:23, 29 February 2020 (UTC)
reply
2 -
Decarbonylation -
wikt:LFe(CO : part of a chemical formula.
Ira Leviton (
talk ) 20:23, 29 February 2020 (UTC)
reply
3 -
Dechloromonas agitata strain CKB -
wikt:per)chlorate ,
wikt:per)chlorate ,
wikt:per)chlorate : chemistry jargon.
Ira Leviton (
talk ) 20:23, 29 February 2020 (UTC)
reply
1 -
Dechloromonas hortensis -
wikt:per)chlorate : chemistry jargon.
Ira Leviton (
talk ) 20:23, 29 February 2020 (UTC)
reply
3 -
Decomplexation -
wikt:arene)Cr ,
wikt:arene)Cr : chemistry jargon.
Ira Leviton (
talk ) 20:23, 29 February 2020 (UTC)
reply
2 -
Dedicated 2 the Oldies 2 -
wikt:he's : part of a song title.
Ira Leviton (
talk ) 20:23, 29 February 2020 (UTC)
reply
1 -
Deena Errampalli - (probably OK:
wikt:statellite ): corrected to satellite.
Ira Leviton (
talk ) 20:23, 29 February 2020 (UTC)
reply
2 -
Deferasirox -
wikt:yl)benzoic : part of a chemical name.
Ira Leviton (
talk ) 21:54, 29 February 2020 (UTC)
reply
1 -
Degree symbol - space]b0: software jargon.
Ira Leviton (
talk ) 21:54, 29 February 2020 (UTC)
reply
4 -
Dehalogenation -
wikt:manganese(II ,
wikt:Fe(acac ,
wikt:radicophiles : chemistry notation.
Ira Leviton (
talk ) 21:54, 29 February 2020 (UTC)
reply
5 -
Deinococcus radiodurans -
wikt:manganese(II ,
wikt:radiophilus : chemistry notation and genus name Deinococcus radiophilus".
Ira Leviton (
talk ) 21:54, 29 February 2020 (UTC)
reply
4 -
Delay composition -
wikt:tin(IV ,
wikt:bismuth(III ,
wikt:lead(II ,
wikt:lead(IV : chemistry notations.
Ira Leviton (
talk ) 22:32, 29 February 2020 (UTC)
reply
3 -
Della Rovere Chapel (Santa Maria del Popolo) - CARD[INALI, VIRG[INIS: demonstrating a historical inscription with abbreviations.
Ira Leviton (
talk ) 22:32, 29 February 2020 (UTC)
reply
1 -
Delph -
wikt:ge)delf : intentional, apparently to show more than one form of an Old English word.
Ira Leviton (
talk ) 22:32, 29 February 2020 (UTC)
reply
1 -
Delphinidin-3-O-(6-p-coumaroyl)glucoside -
wikt:coumaroyl)glucoside : part of a chemical name.
Ira Leviton (
talk ) 22:32, 29 February 2020 (UTC)
reply
1 -
Delta Delphini -
wikt:kA7hF0mF0(IV : an astronomical designation of a star.
Ira Leviton (
talk ) 22:32, 29 February 2020 (UTC)
reply
1 -
Delta bond -
wikt:octachlorodirhenate(III : chemistry notation.
Ira Leviton (
talk ) 22:32, 29 February 2020 (UTC)
reply
1 -
Deluhi - Visual[ism: part of an album name.
Ira Leviton (
talk ) 22:32, 29 February 2020 (UTC)
reply
1 -
Demetrius III Eucaerus - Deme]trius: translation of an inscription with an abbreviation.
Ira Leviton (
talk ) 18:59, 1 March 2020 (UTC)
reply
2 -
Demochristian Party of Albania -
wikt:CDPA)develops (probably OK:
wikt:jubily ): typo help inline tag added.
Ira Leviton (
talk ) 18:59, 1 March 2020 (UTC)
reply
4 -
Demoxytocin -
wikt:acid)oxytocin : part of a chemical name.
9 -
Dempster–Shafer theory -
wikt:Bel(red ,
wikt:Bel(green ,
wikt:Bel(red : mathematical notation.
Ira Leviton (
talk ) 18:59, 1 March 2020 (UTC)
reply
2 -
Dendralene -
wikt:copper(II ,
wikt:ivyanes : chemistry terminology and a plural chemical name.
Ira Leviton (
talk ) 20:02, 1 March 2020 (UTC)
reply
5 -
Denigés' reagent -
wikt:mercury(II ,
wikt:mercury(II : chemistry notation.
Ira Leviton (
talk ) 20:02, 1 March 2020 (UTC)
reply
6 -
Densha Otoko (TV series) -
wikt:you ,
wikt:you : both are part of "thank you", mentioning a thank you present.
Ira Leviton (
talk ) 20:02, 1 March 2020 (UTC)
reply
2 -
Desiccant -
wikt:hexaaquacobalt(II : chemistry notation.
Ira Leviton (
talk ) 01:03, 2 March 2020 (UTC)
reply
1 -
Detachment (territory) - at]tach: written to show a word derivation.
Ira Leviton (
talk ) 01:03, 2 March 2020 (UTC)
reply
5 -
Detroit International Riverfront -
wikt:it's : inadvertent detection of "Detroit's"".
4 -
Developmental toxicity - (probably OK:
wikt:cavitaion ): corrected to cavitation.
Ira Leviton (
talk ) 02:18, 2 March 2020 (UTC)
reply
1 -
Device independence -
wikt:FORMAT(A20 : software programming language.
Ira Leviton (
talk ) 02:18, 2 March 2020 (UTC)
reply
2 -
Dextromoramide -
wikt:diphenylbutyryl)pyrrolidine ,
wikt:moramides : chemical terms, the latter is plural.
Ira Leviton (
talk ) 02:18, 2 March 2020 (UTC)
reply
1 -
Dextrose equivalent -
wikt:copper(II : chemical notation.
Ira Leviton (
talk ) 02:18, 2 March 2020 (UTC)
reply
2 -
Dhaasippen -
wikt:thumbhai ,
wikt:thumbhai : the local name for a certain flower.
Ira Leviton (
talk ) 03:41, 2 March 2020 (UTC)
reply
2 -
Dhamaal -
wikt:Manav(Javed ,
wikt:it's : inadvertent detection of "Dacoit's".
1 -
Dhamtari -
wikt:morabulum : seems to be a local name for a tree or nut.
Ira Leviton (
talk ) 03:41, 2 March 2020 (UTC)
reply
1 -
DiDi -
wikt:ʈʂʰúɕɪ̌ŋ : this is supposed to show pronunciation.
Ira Leviton (
talk ) 20:11, 2 March 2020 (UTC)
reply
10 -
Diabetes and deafness -
wikt:tRNALeu(UUR ,
wikt:tRNALeu(UUR ,
wikt:tRNALeu(UUR ,
wikt:tRNALeu(UUR ,
wikt:tRNALeu(UUR ,
wikt:tRNALeu(UUR ,
wikt:tRNALeu(UUR ,
wikt:tRNALeu(UUR ,
wikt:tRNALeu(UUR : molecular biology jargon.
Ira Leviton (
talk ) 20:11, 2 March 2020 (UTC)
reply
2 -
Diallyl disulfide -
wikt:di(alkylthio : part of a chemical name.
Ira Leviton (
talk ) 20:11, 2 March 2020 (UTC)
reply
2 -
Diaminohydroxyphosphoribosylaminopyrimidine deaminase -
wikt:phosphoribosylamino)uracil ,
wikt:phosphoribosylamino)uracil : parts of chemical names.
Ira Leviton (
talk ) 20:11, 2 March 2020 (UTC)
reply
1 -
Diazodiphenylmethane -
wikt:mercury(II : chemical notation.
Ira Leviton (
talk ) 20:11, 2 March 2020 (UTC)
reply
1 -
Dibenzylideneacetone -
wikt:tris(dibenzylideneacetone : part of a chemical name.
Ira Leviton (
talk ) 20:11, 2 March 2020 (UTC)
reply
1 -
Dibromine monoxide -
wikt:mercury(II : chemical notation.
Ira Leviton (
talk ) 20:11, 2 March 2020 (UTC)
reply
2 -
Dibutyltin dilaurate -
wikt:dibutyltin(IV ,
wikt:hexamitosis : a chemical notation and a parasitic disease of birds.
Ira Leviton (
talk ) 20:11, 2 March 2020 (UTC)
reply
1 -
Dicarbonyl(acetylacetonato)rhodium(I) -
wikt:Dicarbonyl(acetylacetonato : part of a chemical name.
Ira Leviton (
talk ) 22:35, 2 March 2020 (UTC)
reply
3 -
Dicarbonyltris(triphenylphosphine)ruthenium(0) -
wikt:ruthenium(II ,
wikt:ruthenium(II : chemical notations.
Ira Leviton (
talk ) 22:35, 2 March 2020 (UTC)
reply
1 -
Dichlorine heptoxide -
wikt:chlorine(VII : chemical notation.
Ira Leviton (
talk ) 22:35, 2 March 2020 (UTC)
reply
1 -
Dichlorine monoxide -
wikt:mercury(II : chemical notation.
Ira Leviton (
talk ) 22:35, 2 March 2020 (UTC)
reply
1 -
Dichloro(1,2-bis(diphenylphosphino)ethane)nickel -
wikt:nickel(II : part of a chemical name and a chemical notation.
Ira Leviton (
talk ) 22:35, 2 March 2020 (UTC)
reply
2 -
Dichloro(1,3-bis(diphenylphosphino)propane)nickel - propane]nickel,
wikt:nickel(II : chemical notation.
Ira Leviton (
talk ) 22:35, 2 March 2020 (UTC)
reply
1 -
Dichloro(cycloocta-1,5-diene)platinum(II) -
wikt:Pt(cod : part of a chemical name.
Ira Leviton (
talk ) 22:35, 2 March 2020 (UTC)
reply
4 -
Dichlorobis(ethylenediamine)nickel(II) -
wikt:nickel(II ,
wikt:Ni(en ,
wikt:Ni(en ,
wikt:nickel(II : chemical notation.
Ira Leviton (
talk ) 22:35, 2 March 2020 (UTC)
reply
4 -
Dichlorobis(triphenylphosphine)nickel(II) -
wikt:nickel(II ,
wikt:nickel(II ,
wikt:nickel(II ,
wikt:nickel(II : chemical notations.
Ira Leviton (
talk ) 22:35, 2 March 2020 (UTC)
reply
1 -
Dichlorotetrakis(dimethylsulfoxide)ruthenium(II) -
wikt:ruthenium(II : chemical notation.
Ira Leviton (
talk ) 22:35, 2 March 2020 (UTC)
reply
3 -
Dicistroviridae -
wikt:Hel(helicase ,
wikt:Pro(protease ,
wikt:RdRp(polymerase : molecular biology jargon.
Ira Leviton (
talk ) 22:35, 2 March 2020 (UTC)
reply
2 -
Dicobalt edetate -
wikt:Co(EDTA ,
wikt:Co(EDTA : chemical abbreviation.
Ira Leviton (
talk ) 22:35, 2 March 2020 (UTC)
reply
4 -
Dicoronylene - benzo[10, bc]coronene: part of a chemical name.
Ira Leviton (
talk ) 22:35, 2 March 2020 (UTC)
reply
1 -
Dictionary of American Naval Aviation Squadrons -
wikt:VP(AM : U.S. Navy jargon.
Ira Leviton (
talk ) 22:35, 2 March 2020 (UTC)
reply
1 -
Diene -
wikt:butadiene)iron : part of a chemical name.
Ira Leviton (
talk ) 02:25, 3 March 2020 (UTC)
reply
4 -
Diethylaluminium cyanide - bis[di,
wikt:Bis(tert : parts of chemical names.
Ira Leviton (
talk ) 02:25, 3 March 2020 (UTC)
reply
3 -
Diethylaminosulfur trifluoride -
wikt:difluoro(morpholino : part of a chemical name.
Ira Leviton (
talk ) 02:25, 3 March 2020 (UTC)
reply
1 -
Diethylenetriamine -
wikt:Co(dien : part of a chemical name.
Ira Leviton (
talk ) 02:25, 3 March 2020 (UTC)
reply
1 -
Diethylethanolamine -
wikt:cyclo(CH : part of a chemical name.
Ira Leviton (
talk ) 02:25, 3 March 2020 (UTC)
reply
1 -
Diethylphosphite -
wikt:phosphorus(III : chemical notation.
Ira Leviton (
talk ) 02:25, 3 March 2020 (UTC)
reply
1 -
Dieudonné determinant -
wikt:det(AB : part of a mathematical notation.
Ira Leviton (
talk ) 02:25, 3 March 2020 (UTC)
reply
5 -
Diferric-transferrin reductase - transferrin[Fe, transferrin[Fe, transferrin[Fe, transferrin[Fe, transferrin[Fe: chemistry notation.
Ira Leviton (
talk ) 02:25, 3 March 2020 (UTC)
reply
1 -
Different ideal -
wikt:tr(xy : part of a mathematical notation.
Ira Leviton (
talk ) 02:25, 3 March 2020 (UTC)
reply
2 -
Diglucosyl diacylglycerol synthase -
wikt:glucopyranosyl)sn ,
wikt:glucopyranosyl)sn : parts of chemical names.
Ira Leviton (
talk ) 02:25, 3 March 2020 (UTC)
reply
4 -
Dihydrolipoyllysine-residue (2-methylpropanoyl)transferase -
wikt:dihydrolipoyl)lysine ,
wikt:dihydrolipoyl)lysine ,
wikt:dihydrolipoyl)lysine ,
wikt:dihydrolipoyl)lysine : parts of chemical names.
Ira Leviton (
talk ) 02:25, 3 March 2020 (UTC)
reply
2 -
Dihydroorotate dehydrogenase -
wikt:tm1b(EUCOMM ,
wikt:dystosis : molecular biology jargon and an arcane medical term.
Ira Leviton (
talk ) 02:25, 3 March 2020 (UTC)
reply
1 -
Diindenoperylene - lm]perylene: part of a chemical name.
Ira Leviton (
talk ) 02:25, 3 March 2020 (UTC)
reply
1 -
Diisopropyl ether -
wikt:iron(II : chemistry notation.
Ira Leviton (
talk ) 02:25, 3 March 2020 (UTC)
reply
1 -
Dille–Koppanyi reagent -
wikt:cobalt(II : chemistry notation.
Ira Leviton (
talk ) 02:33, 4 March 2020 (UTC)
reply
1 -
Dillo Dirt -
wikt:cd)pyrene : part of a chemical name.
Ira Leviton (
talk ) 02:33, 4 March 2020 (UTC)
reply
1 -
Dimanganese decacarbonyl - Na[Mn: part of a chemical name.
Ira Leviton (
talk ) 02:33, 4 March 2020 (UTC)
reply
2 -
Dimension theorem for vector spaces -
wikt:dim(range ,
wikt:dim(kernel : mathematical formula jargon.
Ira Leviton (
talk ) 02:33, 4 March 2020 (UTC)
reply
1 -
Dimetamine -
wikt:tolyl)cyclohexanone : part of a chemical name.
Ira Leviton (
talk ) 02:33, 4 March 2020 (UTC)
reply
1 -
Dimethylargininase -
wikt:oxide(NO : part of a chemical name.
Ira Leviton (
talk ) 02:33, 4 March 2020 (UTC)
reply
4 -
Dimethyldichlorosilane - HO[Si,
wikt:nHO(CH ,
wikt:SiRSi(CH ,
wikt:SiRSi(CH : part of a chemical name.
Ira Leviton (
talk ) 02:33, 4 March 2020 (UTC)
reply
1 -
Dimethylglyoxime -
wikt:Ni(dmgH : part of a chemical name.
Ira Leviton (
talk ) 02:33, 4 March 2020 (UTC)
reply
2 -
Diocese of Buto -
wikt:Butien(sis : showing a Latin noun form.
Ira Leviton (
talk ) 14:43, 4 March 2020 (UTC)
reply
1 -
Diocese of Moldovița -
wikt:Moldavien(sis : showing a Latin noun form.
Ira Leviton (
talk ) 14:43, 4 March 2020 (UTC)
reply
2 -
Diode–transistor logic -
wikt:CE(sat : part of a mathematical formula.
Ira Leviton (
talk ) 14:43, 4 March 2020 (UTC)
reply
4 -
Diol -
wikt:manganate(VII ,
wikt:manganate(VII ,
wikt:RCH(OH ,
wikt:dioyl : chemistry notations.
Ira Leviton (
talk ) 14:43, 4 March 2020 (UTC)
reply
4 -
Dipeptide -
wikt:RCH(NHP ,
wikt:RCH(NHP ,
wikt:NH(CHR : parts of chemical formulas.
Ira Leviton (
talk ) 14:43, 4 March 2020 (UTC)
reply
1 -
Dipeptidyl-peptidase II -
wikt:dipeptidyl(amino : part of a chemical name.
Ira Leviton (
talk ) 14:43, 4 March 2020 (UTC)
reply
3 -
Diphenyl disulfide -
wikt:CH(SPh ,
wikt:lead(IV :: chemistry formulas/notation.
Ira Leviton (
talk ) 14:43, 4 March 2020 (UTC)
reply
3 -
Diphenylethylenediamine -
wikt:cymene)Ru ,
wikt:PhCH(OH : parts of chemical formulas.
Ira Leviton (
talk ) 14:43, 4 March 2020 (UTC)
reply
16 -
Diphosphagermylene -
wikt:fluorosilyl)silylphosphanides : part of a chemical name.
Ira Leviton (
talk ) 14:43, 4 March 2020 (UTC)
reply
1 -
Diphosphorus tetroxide -
wikt:phosphorus(III : chemistry notation.
Ira Leviton (
talk ) 14:43, 4 March 2020 (UTC)
reply
1 -
Diphtheria toxin -
wikt:ribosyl)diphthamide : part of a chemical formula.
Ira Leviton (
talk ) 14:43, 4 March 2020 (UTC)
reply
1 -
Dir En Grey discography - Vulgar[ism: part of a song name.
Ira Leviton (
talk ) 02:53, 5 March 2020 (UTC)
reply
1 -
Direct Consular Filing -
wikt:Widow(er : in a title of a form, so it applies to both widows and widowers.
Ira Leviton (
talk ) 02:53, 5 March 2020 (UTC)
reply
2 -
Direct bonding -
wikt:Si(OR : chemical notation.
Ira Leviton (
talk ) 02:53, 5 March 2020 (UTC)
reply
2 -
Dirichlet density -
wikt:log(10 ,
wikt:let's : mathematical notation and inadvertent detection of "Dirichlet's".
1 -
Disney Digital Network -
wikt:how's : inadvertent detection of "show's".
Ira Leviton (
talk ) 04:06, 5 March 2020 (UTC)
reply
1 -
Disulfur difluoride -
wikt:Silver(II : chemistry notation.
Ira Leviton (
talk ) 16:55, 5 March 2020 (UTC)
reply
3 -
Dithiocarbamate - Na[CH: chemistry notation.
Ira Leviton (
talk ) 02:12, 6 March 2020 (UTC)
reply
3 -
Dithionite -
wikt:iron(III ,
wikt:iron(II ,
wikt:iron(III : chemistry notations.
Ira Leviton (
talk ) 02:12, 6 March 2020 (UTC)
reply
5 -
Ditungsten tetra(hpp) -
wikt:ditungsten(II ,
wikt:tetra(hpp ,
wikt:copper(II : chemistry notations.
Ira Leviton (
talk ) 02:12, 6 March 2020 (UTC)
reply
2 -
Diversi-Dial -
wikt:unBlitz : the name of a software program.
Ira Leviton (
talk )
5 -
Divorce law by country -
wikt:widow(er ,
wikt:widow(er : written deliberately to show widow and widower in law.
Ira Leviton (
talk ) 02:12, 6 March 2020 (UTC)
reply
2 -
Do Me (Koda Kumi song) -
wikt:re(LIVE ,
wikt:re(CORD : names of songs.
Ira Leviton (
talk ) 02:12, 6 March 2020 (UTC)
reply
1 -
Dobama's Night Kitchen -
wikt:LUV(SIC : the name of a song.
Ira Leviton (
talk ) 02:12, 6 March 2020 (UTC)
reply
3 -
Doctor Who (2013 specials) -
wikt:Five(ish ,
wikt:Five(ish ,
wikt:how's : in the name of a show, and inadvertent detection of the word "show's".
Ira Leviton (
talk ) 02:12, 6 March 2020 (UTC)
reply
1 -
Document International Human Rights Documentary Film Festival -
wikt:sh(OUT : part of the name of an artwork.
Ira Leviton (
talk ) 02:12, 6 March 2020 (UTC)
reply
1 -
Doebner–Miller reaction -
wikt:scandium(III : chemistry notation.
Ira Leviton (
talk ) 03:04, 6 March 2020 (UTC)
reply
2 -
Dolní Marklovice -
wikt:ow)ice ,
wikt:ow)itz : demonstrating Slavic word endings.
Ira Leviton (
talk ) 03:04, 6 March 2020 (UTC)
reply
1 -
Domebo Canyon, Oklahoma -
wikt:sphaerids : seems legit.
Ira Leviton (
talk ) 03:04, 6 March 2020 (UTC)
reply
3 -
Domenico and Francesco Pizzigano -
wikt:Ge)rardus ,
wikt:rardus ,
wikt:rardus : from partial inscriptions in a medieval document.
Ira Leviton (
talk ) 03:04, 6 March 2020 (UTC)
reply
2 -
Domestication of the Syrian hamster -
wikt:BM(NH ,
wikt:hamsteries : a museum designation written in jargon, and a legitimate plural word.
Ira Leviton (
talk ) 03:04, 6 March 2020 (UTC)
reply
2 -
Domnus of Pannonia -
wikt:Stribon(ensis ,
wikt:Stridon(ensis : alternative Latin word forms.
Ira Leviton (
talk ) 03:04, 6 March 2020 (UTC)
reply
3 -
Domžale -
wikt:Domsell(sdorf ,
wikt:unselsdorf : partial words, being used to show word derivations.
Ira Leviton (
talk ) 03:04, 6 March 2020 (UTC)
reply
2 -
Donald R. Paul -
wikt:Poly(ethylene ,
wikt:Poly(ethylene : chemistry notations.
Ira Leviton (
talk ) 04:11, 7 March 2020 (UTC)
reply
1 -
Dopamine receptor D4 -
wikt:yl)propanone : part of a chemical name.
Ira Leviton (
talk ) 20:27, 7 March 2020 (UTC)
reply
1 -
Dose–response relationship -
wikt:log(dose : mathematical formula.
Ira Leviton (
talk ) 20:27, 7 March 2020 (UTC)
reply
1 -
Double exponential moving average -
wikt:EMA(EMA : mathematical notation.
Ira Leviton (
talk ) 21:44, 7 March 2020 (UTC)
reply
2 -
Douglas F4D Skyray -
wikt:VMF(AW ,
wikt:VMF(AW : United States Navy jargon.
Ira Leviton (
talk ) 21:44, 7 March 2020 (UTC)
reply
1 -
Douglas Ferguson (artist) -
wikt:he's : inadvertent detection of "Forsythe's".
Ira Leviton (
talk ) 21:44, 7 March 2020 (UTC)
reply
2 -
Douglas G. Hurley -
wikt:VMFA(AW ,
wikt:VMFA(AW : United States Navy jargon.
Ira Leviton (
talk ) 21:44, 7 March 2020 (UTC)
reply
1 -
Douglas T. Kenrick -
wikt:non)conformity : part of a journal article title.
Ira Leviton (
talk ) 21:44, 7 March 2020 (UTC)
reply
1 -
Dove (toiletries) -
wikt:regret(ed : fixed spelling to regret(ted)"; it's from a quotation.
Ira Leviton (
talk ) 21:44, 7 March 2020 (UTC)
reply
1 -
Downtown Community House - prod[ded: brackets used to clarify a quotation.
Ira Leviton (
talk ) 21:44, 7 March 2020 (UTC)
reply
1 -
Doyle–Kirmse reaction -
wikt:furyl)carbenoids : chemistry jargon.
Ira Leviton (
talk ) 21:44, 7 March 2020 (UTC)
reply
2 -
Drakens Gränd - gr[änd: written deliberately.
Ira Leviton (
talk ) 20:49, 9 March 2020 (UTC)
reply
1 -
Dresden Triptych - OM]PLEVIT: from an old inscription.
Ira Leviton (
talk ) 20:49, 9 March 2020 (UTC)
reply
1 -
Driving America Forward Act - get[ting: paraphrasing a quotation.
Ira Leviton (
talk ) 01:13, 10 March 2020 (UTC)
reply
1 -
Driving licence in Hong Kong -
wikt:class(es : quoting a law.
Ira Leviton (
talk ) 01:13, 10 March 2020 (UTC)
reply
1 -
Dropull -
wikt:Hadrianopolitan(us : showing a Latin ending.
Ira Leviton (
talk ) 01:13, 10 March 2020 (UTC)
reply
1 -
Drosera katangensis -
wikt:B2ab(iii : quoting subsection of law.
Ira Leviton (
talk ) 01:13, 10 March 2020 (UTC)
reply
1 -
Dubai 33 -
wikt:here's - part of a title
Strickesel (
talk )
2 -
Duncan Barrett - avoid[ing,
wikt:your : in single quotes, put them in double
Whisperjanes (
talk ) 06:26, 8 March 2020 (UTC)
reply
1 -
Dura, Africa -
wikt:Duren(sis : some sort of Latin addition to the end of a word. Not sure what to do with it
Whisperjanes (
talk ) 06:26, 8 March 2020 (UTC)
reply
3 -
Dutch Indies literature -
wikt:Rubber(1931 (probably OK:
wikt:kampsyndroom ,
wikt:haarwrong ): Dutch language titles
Whisperjanes (
talk ) 06:26, 8 March 2020 (UTC)
reply
3 -
Dutch exonyms - (probably OK:
wikt:zevenburgen ) - rare Dutch exonym of Transylvania
Whisperjanes (
talk ) 06:26, 8 March 2020 (UTC)
reply
3 -
Dutchbat -
wikt:… (probably OK:
wikt:draaginsigne ): ... = in quotes; draaginsigne = name of insignia
Whisperjanes (
talk ) 06:26, 8 March 2020 (UTC)
reply
1 -
Dutton Guilt Edged Mysteries -
wikt:Noir(ish : novel name
Whisperjanes (
talk ) 06:26, 8 March 2020 (UTC)
reply
6 -
Duty to rescue - (probably OK:
wikt:unterlassene ) - part of phrase in quotes
Whisperjanes (
talk ) 06:26, 8 March 2020 (UTC)
reply
1 -
Dwarf corydoras -
wikt:sub)tropical - correct
Strickesel (
talk )
2 -
Dyadic Encoding -
wikt:dya(2n ,
wikt:dya(2n - chemical notation
Strickesel (
talk )
1 -
Dye decolorizing peroxidase -
wikt:yl)amino - chemical notation
Strickesel (
talk )
1 -
Dynamic mechanical analysis -
wikt:poly(acrylonitrile - chemical notation
Strickesel (
talk )
3 -
Dynamic scraped surface heat exchanger -
wikt:semi)empirical ,
wikt:Fa(Re ,
wikt:Nu(Re - chemical notation
Strickesel (
talk )
3 -
Dysplastic nevus syndrome -
wikt:p16(INK4a ,
wikt:p14(ARF ,
wikt:p16(INK4 - chemical notation
Strickesel (
talk )
4 -
Dysprosium -
wikt:dysprosium(III ,
wikt:dysprosium(III ,
wikt:kozoite ,
wikt:dysprositos - chemical notation
Strickesel (
talk )
1 -
Dysprosium acetylacetonate -
wikt:Dy(acac - chemical notation
Strickesel (
talk )
2 -
Dysprosium chloride -
wikt:Dysprosium(II ,
wikt:Dysprosium(III - chemical notation
Strickesel (
talk )
5 -
Dysprosium(III) chloride -
wikt:Dysprosium(III ,
wikt:Dysprosium(III ,
wikt:dysprosium(III ,
wikt:dysprosium(III ,
wikt:Dysprosium(III - chemical notation
Strickesel (
talk )
1 -
Dysprosium(III) oxide -
wikt:dysprosium(III - chemical notation
Strickesel (
talk )
1 -
Dystis -
wikt:Dystien(sis - correct
Strickesel (
talk )
2 -
Dzikie Pola (role-playing game) -
wikt:dis)advantages ,
wikt:szablas - correct
Strickesel (
talk )
1 -
Dülük -
wikt:Dolichen(us - correct
Strickesel (
talk )
2 -
DC Universe Online -
wikt:exobytes ,
wikt:exobytes : a robot-like device in the DC Universe Online game.
1 -
DCTN2 -
wikt:dynamitin a subunit of dynactin, a macromolecular complex involved in several cellular functions.
2 -
DJ Brace -
wikt:maticulous ,
wikt:maticulous : The name of one of this DJ's albums, spelled with a small 'm', too.
1 -
Dale Hample -
wikt:inventional : meaning the act of inventing. A bit specialized, but legitimate.
1 -
Daniela Poggi -
wikt:quoio : Italian?
2 -
Daniele Trinchero -
wikt:iXem ,
wikt:iXem : name of a company.
1 -
Danny Deever -
wikt:undred : written as " 'undred" (meaning "hundred") in a poem.
1 -
Danny Devos -
wikt:browntones : a musical term.
1 -
Dansker -
wikt:danzker : an alternative spelling of the subject of the page.
1 -
Darren Soto -
wikt:eMgage : name of a Democratic political action committee.
1 -
Darwin Jones -
wikt:unsolveable : in a quotation. There's no access to the original source, a comic book, so I have no way to check if it appeared with that spelling.
19 -
Dashiki -
wikt:danshiki ,
wikt:danshiki ,
wikt:danshiki ,
wikt:danshiki ,
wikt:danshiki ,
wikt:danshiki ,
wikt:danshiki ,
wikt:danshiki ,
wikt:danshiki ,
wikt:danshiki ,
wikt:danshiki ,
wikt:danshiki ,
wikt:danshiki ,
wikt:danshiki ,
wikt:danshiki ,
wikt:danshiki ,
wikt:danshikis ,
wikt:danshiki ,
wikt:danshikis : legit - but not English. It's a Hausa word, from which dashiki, the subject of the page, is derived.
1 -
Dave (surname) -
wikt:duvea : ISO lang code for Middle Indo-Aryan?
1 -
David Grant (producer) -
wikt:sextoon : meant as a sex cartoon. Not sure if it's a real word.
1 -
David Tall -
wikt:procepts : plural of
procept .
1 -
Daydream (1964 film) -
wikt:eroductions : an 1960s term for soft porn.
1 -
De Garde Brewing -
wikt:foeders : a term for barrel. Maybe archaic.
1 -
De Morgan -
wikt:tilist : a ceramics worker who works with tiles.
2 -
De Stille Kracht (TV series) -
wikt:goena ,
wikt:goena : a Dutch or Indonesian word.
3 -
DeSoL -
wikt:saZon ,
wikt:saZon ,
wikt:saZon : the name of a record company. It's correct.
5 -
Dead Before Dawn -
wikt:zemons ,
wikt:zemons ,
wikt:zemons ,
wikt:zemons ,
wikt:zemons : a combination of zombie and demon, a type of creature in the movie that's the subject of the page.
1 -
Dead Weather Machine -
wikt:respiritory . Misspelled, followed by a [sic].
1 -
Deb Pearce -
wikt:foQus : in a song title. With a capital Q.
1 -
Deb Verhoeven -
wikt:kinomatics : probably not a real word, but it's in a reference.
1 -
Decoder Ring Theatre -
wikt:xenocidal : adjectival form of xenocide. Legit.
1 -
Deed -
wikt:sanads : plural of sanad, a deed granted to the rulers of princely states in British India. Not an English word, though.
1 -
Deep Navigation Colliery -
wikt:byats : unclear. -- OK,
wikt:Appendix:Dictionary of Mining, Mineral, and Related Terms/B/3 has "biat", also spelled "byat"
Jkgree (
talk ) 16:27, 20 February 2019 (UTC)
reply
1 -
Deep Springs College -
wikt:feedman : legit. A type of ranch hand or farm worker.
1 -
Deep Springs Plantation -
wikt:axatite : legit. A type of rock or mineral in a meteorite.
1 -
Degaldoruwa Raja Maha Vihara -
wikt:digge : a word from a language used on the Indian subcontinent, probably Tamil or Sinhalese.
1 -
Deltras F.C. -
wikt:furiest : I can't figure out what word is intended here -- furriest? most furious?
8 -
Demoicracy -
wikt:demoicratic ,
wikt:demoicratic ,
wikt:demoicrats ,
wikt:demoicratic ,
wikt:demoicratic ,
wikt:demoicratic ,
wikt:demoicratic ,
wikt:demoicratically . See the title of the page. A bit forced, but seems legit.
1 -
Denis Sullivan (schooner) -
wikt:raffee : a type of topsail. See
topsail .
1 -
Dennis Merzel -
wikt:zuise : a Japanese word. See
Zen ranks and hierarchy .
3 -
Dentures -
wikt:spruing ,
wikt:cusion ,
wikt:hndy : spruing needs Wiktionary addition? cleared other spelling errors
2 -
Department of Archaeology -
wikt:eology ,
wikt:eology : used correctly, as part of arch(a)eology.
1 -
Deportivo Saprissa -
wikt:choreos : no clue; it translates as "complaint" which doesn't make sense in context.
1 -
Der König in Thule -
wikt:goldnen : German for golden.
1 -
Deserticossus janychar -
wikt:stroky : unclear.
1 -
Devil May Cry (video game) -
wikt:jagginess : slang for a certain type of artifact in video or graphic images.
1 -
Devlin v. Smith -
wikt:otwithstanding : in a quotation, written as "[N]otwithstanding..."
1 -
Dey -
wikt:deylicate : a form of government of Algeria in the early 1800s.
1 -
Dhumpa sangita -
wikt:mardala : a musical instrument used in India?
2 -
Diana (1818 ship) -
wikt:buggalows ,
wikt:buggalows : plural, a type of boat mainly used in the Arabian Sea, similar to a dhow.
1 -
Dick Turpin -
wikt:higlers : an English term for a peddler or travelling seller of goods.
1 -
Dillalah -
wikt:yarron : a type of grass or vegetation in Australia. From a newspaper in reference #1 of the article.
1 -
Direct memory access -
wikt:deasserted : computer programming jargon. Probably not a real word.
1 -
Discogs -
wikt:taghycardia : a product name. With a small 't'.
1 -
Dishwashing -
wikt:gosok : unclear. I think it's an Indonesian term.
1 -
Dithmarschen -
wikt:warfts : plural for an artificial dwelling hill for protection from the sea. Similar to terps.
1 -
Diving at the 1928 Summer Olympics – Men's 3 metre springboard -
wikt:isander : a type of dive (confirmed on olympic's website)
1 -
Diving at the 1932 Summer Olympics – Men's 10 metre platform -
wikt:isander : a type of dive
1 -
Divisional Secretariats of Sri Lanka -
wikt:korales : a colonial district type in Sri Lanka
1 -
Divona -
wikt:deuos : Gaulic, according to article
1 -
Diwan Singh -
wikt:lehran : part of a book title, I capitalized it
1 -
Djinguereber Mosque -
wikt:alhore : unclear, I wasn't able to validate its meaning.
1 -
Domhnall Ó hUiginn -
wikt:reowned : unable to confirm correction with original source of quote ETA: I'm fairly certain the word is "renowned" so I made the change.
Schazjmd (
talk ) 01:20, 26 December 2018 (UTC)
reply
1 -
Domina Eberle Spencer -
wikt:holors : a mathematical entity that is made up of one or more independent quantities, or merates.
1 -
Donikkl Mitmach-Konzert-Show -
wikt:rockt : part of song title
1 -
Dora Riparia -
wikt:duriae : local dialect for canals, made italic
1 -
Doree Lewak -
wikt:reinforc : used in quote to modify tense ("reinforc(ing)"
1 -
Dorothy Bishop -
wikt:hookies : nickname for an award, mentioned in target wiki article, capitalized it to match target
1 -
Dory Reeves -
wikt:ownerhsip : spelled that way in dissertation title, article includes [sic]
2 -
Doubled die -
wikt:hubbings ,
wikt:hubbings : add to wiktionary?
5 -
Douen -
wikt:douens ,
wikt:douens ,
wikt:douens ,
wikt:douens ,
wikt:douens : add to wiktionary?
2 -
Dragon Ball GT: Transformation -
wikt:zenie ,
wikt:zenie : this is a thing in that game
3 -
Dragoneer's Aria -
wikt:lusces ,
wikt:lusces ,
wikt:lusces : this is a thing in that game
3 -
Drinking from shoes -
wikt:shoeys ,
wikt:shoeys ,
wikt:shoeys : plural for "shoey", an Australian term for drinking beer out of one's own shoe.
1 -
Droit Chemin -
wikt:ketsh : not sure which language in use
6 -
Drua -
wikt:druas ,
wikt:druas ,
wikt:druas ,
wikt:druas ,
wikt:druas ,
wikt:druas : plural form of the subject of the article
1 -
Drug Equality Alliance -
wikt:maladminstration : this is a word
2 -
Dry ski slope -
wikt:dendix ,
wikt:dendix : a type of fabric
1 -
Dryinus rasnitsyni -
wikt:clypus : scientific term for a part of a wasp's face
1 -
Dual gauge -
wikt:rollbocks : a type of train car, wiki has an article on it
1 -
Dugu Miniautotoys -
wikt:falcet : found this mentioned in other (non-wiki-mirror) articles and described there as a local dialect
1 -
Dundgovi Province -
wikt:mikrs : appears to be a term used in Mongolia for transit option, found on other (non-wiki-mirror) sites // may be non-English? -
Xurizuri (
talk ) 06:26, 4 February 2021 (UTC)
reply
1 -
Duros (food) -
wikt:durros : included as an alternate spelling of "duros"
1 -
Dustobod -
wikt:stobod : part of name (info box label, it's spelled as "Du'stobod")
1 -
Dutch pacification campaign on Formosa -
wikt:cangans : defined in article as a type of cloth
1 -
Duvenstedt -
wikt:stedt : used in "-stedt" to explain how name was formed
1 -
Dyin' on a Prayer -
wikt:woging - term from the show that the page is about. Monster transformation/glamor. Past/active tense verb 'changing/maintaining a form.' Source:
Fan wiki ... help?
4 -
Dynamic random-access memory -
wikt:deassert ,
wikt:deasserted ,
wikt:deasserted : seems to be technical term, found in other sources
1 -
Dynamic tonality -
wikt:ranats : instrument, wikilinked it to its article
1 -
Dynamic window manager -
wikt:spectrwm : name of a window manager program
1 -
Dzhetyasar culture -
wikt:necropolices : not sure what language, source is in Russian
1 -
Dioscorea communis -
wikt:dimethoxy-7,8-methylenedioxyphenanthrene - chemical notation
T1+
5 -
ESL One Cologne 2016 -
wikt:cajunb ,
wikt:cajunb ,
wikt:sezied ,
wikt:spaze ,
wikt:spaze : nicknames.
Ira Leviton (
talk ) 18:43, 13 September 2020 (UTC)
reply
3 -
ESL Pro League Season 5 -
wikt:devoduvek ,
wikt:ropz ,
wikt:ropz : user names in this game.
Ira Leviton (
talk ) 18:43, 13 September 2020 (UTC)
reply
3 -
East Ambae language -
wikt:cliticised ,
wikt:tangaloi ,
wikt:iaring : a linguistic term and two words from the language.
CateFromArcadia (
talk ) 18:31, 11 September 2020 (UTC)
reply
1 -
Eastern Pomo language -
wikt:commitation : unclear if it's supposed to be commutation.
Ira Leviton (
talk ) 21:51, 13 September 2020 (UTC)
reply
2 -
Ecclesiastical jurisdiction -
wikt:annexal : legit word.
Ira Leviton (
talk ) 20:25, 17 September 2020 (UTC)
reply
3 -
Echinaster -
wikt:perihaemal : a biological term.
CateFromArcadia (
talk ) 19:10, 13 September 2020 (UTC)
reply
6 -
Echinoderm -
wikt:perihaemal ,
wikt:perihaemal ,
wikt:perihaemal ,
wikt:perihaemal ,
wikt:perihaemal ,
wikt:susuhan : biological terms.
CateFromArcadia (
talk ) 19:10, 13 September 2020 (UTC) // I think susuhan is part of a species name, but I'm not sure enough of how they're formatted - the article gives
Thelenota ananas (susuhan ) --
Xurizuri (
talk ) 09:12, 31 January 2021 (UTC)
reply
7 -
Echis carinatus -
wikt:phissi ,
wikt:pamboo ,
wikt:surutai ,
wikt:vireyan ,
wikt:janndi ,
wikt:padkoo ,
wikt:udaneyn : local names for this snake.
Ira Leviton (
talk ) 20:25, 17 September 2020 (UTC)
reply
2 -
Ectoderm specification -
wikt:desuppression : biology term.
Ira Leviton (
talk ) 20:25, 17 September 2020 (UTC)
reply
1 -
Edinoverie -
wikt:coreligionism - a literal translation of the page's title.
CateFromArcadia (
talk ) 19:08, 16 September 2020 (UTC)
reply
2 -
Edward von Lõngus -
wikt:R)estart ,
wikt:estart : part of the name of a song.
Ira Leviton (
talk ) 17:33, 18 September 2020 (UTC)
reply
12 -
Efficient approximately-fair item allocation -
wikt:O(poly ,
wikt:p(Xi) ,
wikt:p(Xi) ,
wikt:p(Xj) ,
wikt:p(Xi) ,
wikt:p(Xi) ,
wikt:p(Xi) ,
wikt:p(Xi) ,
wikt:O(poly ,
wikt:ln(Vmax) ,
wikt:Vi(o) ,
wikt:e)Vi : mathematical formulas.
Ira Leviton (
talk ) 22:44, 18 September 2020 (UTC)
reply
1 -
Egalitarian equivalence -
wikt:min(x : part of a mathematical notation.
Ira Leviton (
talk ) 02:23, 25 September 2020 (UTC)
reply
4 -
Eggja stone -
wikt:a(i ,
wikt:a)u ,
wikt:lagi(s) ,
wikt:harie : runic inscriptions, copied in the article.
Ira Leviton (
talk ) 02:23, 25 September 2020 (UTC)
reply
2 -
Egilina mariella - (OK:
wikt:subnodulose ): seems legit.
Ira Leviton (
talk ) 02:23, 25 September 2020 (UTC)
reply
1 -
Egor Kuroptev -
wikt:deoccupation : seems legit.
Ira Leviton (
talk ) 02:23, 25 September 2020 (UTC)
reply
9 -
Ekphrasis -
wikt:bedness ,
wikt:bedness ,
wikt:bedness ,
wikt:bedness ,
wikt:bedness ,
wikt:bedness ,
wikt:bedness ,
wikt:bedness ,
wikt:bedness : a concept introduced by Plato. (It hasn't caught on.)
Ira Leviton (
talk ) 21:17, 18 September 2020 (UTC)
reply
1 -
Electoral system of Turkey -
wikt:beldes : Seems to be the correct plural of the Turkish word 'belde'.
CateFromArcadia (
talk ) 16:53, 19 September 2020 (UTC)
reply
2 -
Electric vehicle network -
wikt:eflott ,
wikt:eflott : the name of an electric vehicle project, apparently written all lower case.
Ira Leviton (
talk ) 19:35, 25 September 2020 (UTC)
reply
2 -
Electron paramagnetic resonance -
wikt:gzz : part of mathematical notation.
Ira Leviton (
talk ) 19:35, 25 September 2020 (UTC)
reply
11 -
Electronic skin -
wikt:poly(N ,
wikt:di(thiophen , c]pyrrole,
wikt:rehealable ,
wikt:rehealable ,
wikt:rehealable ,
wikt:rehealable : parts of chemical names, and rehealable is mentioned in a reference, so it's legit.
Ira Leviton (
talk ) 19:35, 25 September 2020 (UTC)
reply
1 -
Electrostatic loudspeaker -
wikt:treVolo : a product name.
Ira Leviton (
talk ) 19:35, 25 September 2020 (UTC)
reply
3 - Elektrozavodskaya (Moscow Metro) -
wikt:salietti ,
wikt:duvalu ,
wikt:salietti : types of marble (stone), I'm not sure if they should be capitalized.
Ira Leviton (
talk ) 19:35, 25 September 2020 (UTC)
reply
2 -
Elena and the Secret of Avalor -
wikt:sambarossa ,
wikt:sambarossa : a type of dance, maybe an in-universe term for this story.
Ira Leviton (
talk ) 19:35, 25 September 2020 (UTC)
reply
1 -
Elizabeth Hand -
wikt:aardmen : an in-universe term from one of her books.
Ira Leviton (
talk ) 20:37, 28 September 2020 (UTC)
reply
13 -
Elizabeth Rogers' Virginal Book -
wikt:Symphon(ies) ,
wikt:Symphon(ies) ,
wikt:Alm(aygne) ,
wikt:Alma(ygne) ,
wikt:enioyes ,
wikt:aygne ,
wikt:ygne ,
wikt:ffoote ,
wikt:comne ,
wikt:spaynard ,
wikt:ffinex ,
wikt:flattring ,
wikt:preethe : words in titles of musical pieces.
Ira Leviton (
talk ) 20:37, 28 September 2020 (UTC)
reply
Email sender accreditation -
wikt:accreditee -
accreditee
Emancipation reform of 1861 -
wikt:province(s) ,
wikt:skhod ,
wikt:skhod ,
wikt:batraks - the mir assembly, the skhod (sel'skii skhod ),
Batrak
Emani Sankara Sastry -
wikt:vinyas - Brmara vinyas – a thematic composition
Emberger syndrome -
wikt:A(GATA) - nucleic acid sequence viz., (T/A(GATA)A/G)
Emblem of Kazakhstan -
wikt:uyks - uyks (supports)
Emblem of the West -
wikt:imnt ,
wikt:wnmy - hieroglyph represents imnt "west" or wnmy "right".
Embroidery of India -
wikt:bakhia ,
wikt:bakhia ,
wikt:bakhia ,
wikt:khatava ,
wikt:sozni ,
wikt:gokru ,
wikt:chogas ,
wikt:phatuhi ,
wikt:pugur ,
wikt:mettvi ,
wikt:mukais - all ok
Emic and etic -
wikt:etics - plural of title term
Emma Palladino -
wikt:twelle - Le due twelle
Empire of Man -
wikt:scummies - referred to as Mardukans (or unofficially, scummies)
Employee Stock Ownership Plan -
wikt:k)s - 401(k)s
Employment contract in English law -
wikt:collag ,
wikt:collag ,
wikt:collag ,
wikt:collag - unclear
En (deity) -
wikt:a(t) - from
Proto-Albanian *dźie̅u ̊ *a(t)t (a cognate of
PIE
*Dyḗus ph₂tḗr )
1 -
Encantadia -
wikt:encant(ad) : showing a word derivation.
Ira Leviton (
talk ) 20:28, 24 September 2020 (UTC)
reply
Encarna Sant-Celoni i Verger -
wikt:cassidas - unclear
4 -
Enchanted Garden -
wikt:salangkay ,
wikt:salangkay ,
wikt:salangkay ,
wikt:salangkay : an in-universe term in this story.
Ira Leviton (
talk ) 20:28, 24 September 2020 (UTC)
reply
1 -
Endebjerg -
wikt:flotated : an archaeological term.
CateFromArcadia (
talk ) 18:29, 23 September 2020 (UTC)
reply
Endill -
wikt:ndils - [Æ]ndils iarmungrundaR which is a
kenning for the sea.
1 -
Enga language -
wikt:locationals : a legit word (plural).
Ira Leviton (
talk ) 23:08, 28 September 2020 (UTC)
reply
9 -
England runestones -
wikt:iut(l) ,
wikt:u(a) ,
wikt:s(u) ,
wikt:a)u ,
wikt:tuknuts ,
wikt:skulti ,
wikt:ialbi ,
wikt:siaul ,
wikt:luntunum : inscriptions on stones.
Ira Leviton (
talk ) 23:08, 28 September 2020 (UTC)
reply
3 -
English contract law -
wikt:offerree ,
wikt:misrepresentee ,
wikt:misrepresentee : legal jargon.
Ira Leviton (
talk ) 23:08, 28 September 2020 (UTC)
reply
1 -
English in New Mexico -
wikt:ombers : regional English.
Ira Leviton (
talk ) 23:08, 28 September 2020 (UTC)
reply
2 -
English orthography -
wikt:pattern(s) ,
wikt:oux : showing both singular and plural, and a word ending.
Ira Leviton (
talk ) 23:08, 28 September 2020 (UTC)
reply
1 -
English terms with diacritical marks -
wikt:drowle : showing a pronunciation.
Ira Leviton (
talk ) 23:08, 28 September 2020 (UTC)
reply
4 -
English verbs - e]s, e]s,
wikt:combat(t) : showing word suffixes and spellings.
Ira Leviton (
talk ) 23:08, 28 September 2020 (UTC)
reply
5 -
English-language spelling reform -
wikt:in)definite ,
wikt:in)definit : showing two words.
Ira Leviton (
talk ) 23:08, 28 September 2020 (UTC)
reply
1 -
Enischnomyia -
wikt:steblid : an adjective applicable to flies.
Ira Leviton (
talk ) 23:08, 28 September 2020 (UTC)
reply
1 -
Epaphroditus -
wikt:praefecture : an acceptable spelling.
Ira Leviton (
talk ) 19:32, 28 September 2020 (UTC)
reply
3 -
Epenthesis -
wikt:somepthing ,
wikt:ambrotos ,
wikt:homre : spelled deliberately to show pronunciation.
Ira Leviton (
talk ) 19:32, 28 September 2020 (UTC)
reply
2 -
Epitranscriptomic sequencing - P]NTPs, P]ATP: molecular biology notation.
Ira Leviton (
talk ) 19:32, 28 September 2020 (UTC)
reply
1 -
Epoxydocosapentaenoic acid -
wikt:y(S) : part of a long chemical name.
Ira Leviton (
talk ) 19:32, 28 September 2020 (UTC)
reply
1 -
Eqn (software) -
wikt:neqn : the name of a software program.
Ira Leviton (
talk ) 01:11, 29 September 2020 (UTC)
reply
2 -
Equating coefficients -
wikt:x(x : part of a mathematical formula.
Ira Leviton (
talk ) 01:11, 29 September 2020 (UTC)
reply
1 -
Equatorial spitting cobra -
wikt:toxinological : a legit word.
Ira Leviton (
talk ) 01:11, 29 September 2020 (UTC)
reply
2 -
Equilibrium chemistry -
wikt:TA(i) ,
wikt:TB(i) : parts of mathematical formulas.
Ira Leviton (
talk ) 01:11, 29 September 2020 (UTC)
reply
2 -
Equilibrium constant - K[ML]: part of a mathematical formula.
Ira Leviton (
talk ) 01:11, 29 September 2020 (UTC)
reply
2 -
Equivalence of metrics -
wikt:renormed : mathematical jargon.
Ira Leviton (
talk ) 01:11, 29 September 2020 (UTC)
reply
2 -
Eremophila mitchellii -
wikt:budtha ,
wikt:balvory : local names for this plant.
Ira Leviton (
talk ) 01:11, 29 September 2020 (UTC) // no indication in the article what language these are from, and the reference is a book so I can't check. I also think these have been adopted into English, based on the way websites are using the terms. --
Xurizuri (
talk ) 08:30, 1 February 2021 (UTC)
reply
7 -
Erfworld -
wikt:spidews ,
wikt:twolls ,
wikt:uncroaked ,
wikt:uncroak ,
wikt:arkentool ,
wikt:uncroaking ,
wikt:uncroaked : all in-universe terms in this story.
Ira Leviton (
talk ) 01:11, 29 September 2020 (UTC)
reply
1 -
Ergine -
wikt:cloA : the name of an enzyme.
Ira Leviton (
talk ) 01:11, 29 September 2020 (UTC)
reply
7 -
Ergoline -
wikt:beta(S) ,
wikt:beta(S) ,
wikt:alpha(S) ,
wikt:alpha(S) ,
wikt:clavines ,
wikt:clavines ,
wikt:clavines : parts of chemical names and a group of chemicals.
Ira Leviton (
talk ) 01:11, 29 September 2020 (UTC)
reply
2 -
Erishum I -
wikt:u(m) : showing another spelling.
Ira Leviton (
talk ) 01:53, 29 September 2020 (UTC)
reply
1 -
Erythrogenic toxin -
wikt:speJ : the name of a gene.
Ira Leviton (
talk ) 19:35, 25 September 2020 (UTC)
reply
2 -
Escherichia virus T4 -
wikt:uvsX : the name of a gene.
Ira Leviton (
talk ) 19:35, 25 September 2020 (UTC)
reply
1 -
Eschmeyer nexus -
wikt:cofishes : local name for a fish (plural).
Ira Leviton (
talk ) 19:35, 25 September 2020 (UTC)
reply
5 -
Essen Minster -
wikt:I)DA ,
wikt:Y(ear) ,
wikt:O(ur : from inscriptions on stones.
Ira Leviton (
talk ) 01:15, 26 September 2020 (UTC)
reply
5 -
Estimation of distribution algorithm -
wikt:M(t) ,
wikt:M(t ,
wikt:model(P ,
wikt:M(t) ,
wikt:thresheld : parts of mathematical formulas and an arcane mathematical term - in a citation.
Ira Leviton (
talk ) 15:10, 26 September 2020 (UTC) // More accurately, it's an algorithm. Not sure if it should be treated like code, maths, or something else. --
Xurizuri (
talk ) 09:12, 31 January 2021 (UTC)
reply
1 -
Etang Saumâtre -
wikt:caguey : a local name for a plant.
Ira Leviton (
talk ) 22:33, 26 September 2020 (UTC)
reply
3 -
Eternal Champion (character) -
wikt:ordor ,
wikt:howeve ,
wikt:exalogy : seems to be a word.
Ira Leviton (
talk ) 22:33, 26 September 2020 (UTC)
reply
2 -
Ethernut -
wikt:egnite ,
wikt:proconX : both are company names, lower case.
Ira Leviton (
talk ) 22:33, 26 September 2020 (UTC)
reply
1 -
Etruscan language -
wikt:piratesque : unclear.
Ira Leviton (
talk ) 22:33, 26 September 2020 (UTC) // added the clarify template. hopefully someone fixes it --
Xurizuri (
talk ) 09:12, 31 January 2021 (UTC)
reply
1 -
Etruscan society -
wikt:gamonymic : named after a husband, i.e., Susan wife of John. Analogous to patronymic, matronymic.
Ira Leviton (
talk )
1 -
Etymology of Skye -
wikt:suffigation : a linguistic term that means adding a suffix.
Ira Leviton (
talk ) 22:33, 26 September 2020 (UTC) // an alt spelling of
wikt:suffixation which is on there already. Should make it easy to do (this spelling has been used in a few sources so should be good for wikt). --
Xurizuri (
talk ) 09:12, 31 January 2021 (UTC)
reply
3 -
Eu'Vend -
wikt:coffeena ,
wikt:coffeena ,
wikt:coffeena : the name of a coffee celebration in Europe, correct lower case.
Ira Leviton (
talk ) 22:33, 26 September 2020 (UTC)
reply
1 -
Eudaf Hen -
wikt:Out(h) : showing an alternative or uncertain spelling of an old Welsh word.
Ira Leviton (
talk ) 16:24, 26 September 2020 (UTC)
reply
1 -
Eugraphe -
wikt:noctuine : a type of moth.
Ira Leviton (
talk ) 17:52, 29 September 2020 (UTC)
reply
2 -
Euhoplites -
wikt:lautiform ,
wikt:lautiform : lautiform is an arcane but legit word.
Ira Leviton (
talk ) 17:52, 29 September 2020 (UTC)
reply
1 -
Euphorbia tithymaloides -
wikt:euphorbol : a chemical name.
Ira Leviton (
talk ) 17:52, 29 September 2020 (UTC)
reply
13 -
European rabbit -
wikt:rabbidge ,
wikt:rabbert ,
wikt:rabbette ,
wikt:rabytt ,
wikt:coniz ,
wikt:wareine ,
wikt:warenna ,
wikt:conniniere ,
wikt:coninyere ,
wikt:conilliere ,
wikt:kiniklos : various other languages words, some modern and some dead. --
Xurizuri (
talk ) 09:12, 31 January 2021 (UTC)
reply
1 -
European sprat -
wikt:russlet : another common name for this fish.
Ira Leviton (
talk ) 17:52, 29 September 2020 (UTC)
reply
1 -
Euxinia -
wikt:paleogeologists : a legit word (plural).
Ira Leviton (
talk ) 14:28, 26 September 2020 (UTC)
reply
3 -
Everyday Aesthetics -
wikt:artification ,
wikt:artificating ,
wikt:artificating : jargon in the field of aesthetics.
Ira Leviton (
talk ) 01:53, 29 September 2020 (UTC)
reply
2 -
Evolution of cephalopods -
wikt:coeloids ,
wikt:coeloids : A type of cephalopod.
CateFromArcadia (
talk ) 11:51, 26 September 2020 (UTC)
reply
7 -
Evolutionary history of plants -
wikt:telome ,
wikt:telome ,
wikt:telome ,
wikt:telome ,
wikt:planated ,
wikt:telome ,
wikt:gymnospermic : Biological terms.
CateFromArcadia (
talk ) 11:51, 26 September 2020 (UTC)
reply
6 -
Exec (system call) -
wikt:execlp ,
wikt:envp ,
wikt:envp ,
wikt:envp ,
wikt:envp ,
wikt:execlp : Names of functions.
CateFromArcadia (
talk ) 11:51, 26 September 2020 (UTC)
reply
3 -
Expedition of Dramali -
wikt:delhis ,
wikt:delhis ,
wikt:delhis : unclear.
Ira Leviton (
talk ) 23:33, 27 September 2020 (UTC)
reply
1 -
Explained sum of squares -
wikt:xji : a mathematical notation.
Ira Leviton (
talk ) 23:33, 27 September 2020 (UTC)
reply
3 -
Exposition Universelle (1900) -
wikt:edicules ,
wikt:edicules ,
wikt:edicules : a legit word (plural).
Ira Leviton (
talk ) 23:33, 27 September 2020 (UTC)
reply
3 -
Exsphere (polyhedra) -
wikt:exspheres ,
wikt:exspheres ,
wikt:exspheres : a legit word, plural of the subject of the page.
Ira Leviton (
talk ) 23:33, 27 September 2020 (UTC)
reply
6 -
Extended Window Manager Hints -
wikt:aewm ,
wikt:bspwm ,
wikt:spectrwm ,
wikt:edewm ,
wikt:evilwm ,
wikt:interfacewm : all software programming jargon.
Ira Leviton (
talk ) 23:33, 27 September 2020 (UTC)
reply
TS+DOT+
1 -
E.ventures -
wikt:e.Venture : the name of a company.
Ira Leviton (
talk ) 20:17, 18 September 2020 (UTC)
reply
2 -
ENCA -
wikt:e.Sat ,
wikt:e.Sat : the name of a company.
Ira Leviton (
talk ) 20:17, 18 September 2020 (UTC)
reply
2 -
EV7 The Sun Route -
wikt:n.Vltavou ,
wikt:n.Vltavou : some type of Czech abbreviation, without a space after the period.
Ira Leviton (
talk ) 20:17, 18 September 2020 (UTC)
reply
1 -
Ed Elliot -
wikt:h.Art
1 -
Electrospray ionization - nH]n: part of a chemistry notation.
Ira Leviton (
talk ) 00:30, 20 September 2020 (UTC)
reply
4 -
Elves in fiction -
wikt:miruvor ,
wikt:iynisin ,
wikt:unsingers ,
wikt:iynisin : in-universe terms.
Ira Leviton (
talk ) 01:32, 20 September 2020 (UTC)
reply
1 -
Emanuel Pleitez -
wikt:dot.LA : the name of an online news outlet in Los Angeles.
Ira Leviton (
talk )
3 -
Eoarchean geology -
wikt:protoplate ,
wikt:myloitic ,
wikt:metatonalites :
Ira Leviton (
talk ) 21:02, 22 September 2020 (UTC)
reply
1 -
Epimorphosis -
wikt:regenectin : the name of a protein.
Ira Leviton (
talk ) 02:01, 23 September 2020 (UTC)
reply
4 -
Equative -
wikt:boot(s) ,
wikt:is(are) ,
wikt:this.Neut ,
wikt:was.Masc : seem to be showing word constructions.
Ira Leviton (
talk ) 02:01, 23 September 2020 (UTC)
reply
1 -
Ernie Toshack with the Australian cricket team in England in 1948 -
wikt:ability.N : the N is part of a superscript to indicate there's a note at the end.
Ira Leviton (
talk ) 19:49, 23 September 2020 (UTC)
reply
1 -
Et Fugit Intera Fugit Irreparabile Tempus -
wikt:kl.K : a musician's stage name.
Ira Leviton (
talk ) 02:04, 24 September 2020 (UTC)
reply
1 -
Eubac -
wikt:eu.ESCO : the name of a company.
Ira Leviton (
talk ) 02:04, 24 September 2020 (UTC)
reply
1 -
Evolution of insects -
wikt:fusainized : a legit word.
Ira Leviton (
talk ) 16:01, 24 September 2020 (UTC)
reply
1 -
Evolutionary fauna -
wikt:coleolids : a legit word (plural).
Ira Leviton (
talk ) 16:01, 24 September 2020 (UTC)
reply
1 -
Exact differential equation -
wikt:F(x : part of a mathematical formula.
Ira Leviton (
talk ) 19:12, 24 September 2020 (UTC)
reply
2 -
Excision (musician) -
wikt:ill.Gates ,
wikt:ill.Gates : a musical artist's name.
Ira Leviton (
talk ) 19:12, 24 September 2020 (UTC)
reply
2 -
Exonic splicing silencer -
wikt:TG)mT ,
wikt:TG)mT : a molecular biology abbreviation.
Ira Leviton (
talk ) 19:12, 24 September 2020 (UTC)
reply
4 -
Extrachromosomal DNA -
wikt:invertrons ,
wikt:invertron : legit (singular and plural),
Ira Leviton (
talk ) 19:12, 24 September 2020 (UTC)
reply
TS+COMMA+
49 -
E6 (mathematics) -
wikt:E6,ad ,
wikt:E6,ad ,
wikt:E6,sc ,
wikt:E6,ad ,
wikt:E6,sc ,
wikt:E6,ad ,
wikt:E6,ad ,
wikt:E6,sc ,
wikt:E6,ad ,
wikt:E6,sc ,
wikt:E6,ad ,
wikt:E6,sc ,
wikt:E6,ad ,
wikt:E6,sc ,
wikt:E6,ad ,
wikt:E6,sc ,
wikt:E6,ad ,
wikt:Aut(E ,
wikt:Gal(k) ,
wikt:sc(q) ,
wikt:ad(q) ,
wikt:SL(n ,
wikt:PGL(n ,
wikt:PSL(n ,
wikt:sc(q) ,
wikt:ad(q) ,
wikt:ad(q) ,
wikt:sc(q) ,
wikt:ad(q) ,
wikt:sc(q) ,
wikt:ad(q) ,
wikt:sc(q) ,
wikt:ad(q) ,
wikt:sc(q) ,
wikt:ad(q) ,
wikt:sc(q) ,
wikt:ad(q) ,
wikt:sc(q) ,
wikt:ad(q) ,
wikt:sc(q ,
wikt:ad(q ,
wikt:sc(q) ,
wikt:ad(q) ,
wikt:sc(q) ,
wikt:ad(q) ,
wikt:sc(q) ,
wikt:sc(q) ,
wikt:ad(q) ,
wikt:ad(q) : parts of mathematical formulas.
Ira Leviton (
talk ) 03:14, 13 September 2020 (UTC)
reply
28 -
E7 (mathematics) -
wikt:E7,sc ,
wikt:E7,ad ,
wikt:E7,sc ,
wikt:E7,ad ,
wikt:E7,ad ,
wikt:E7,sc ,
wikt:E7,ad ,
wikt:E7,sc ,
wikt:E7,ad ,
wikt:E7,sc ,
wikt:E7,ad ,
wikt:E7,ad ,
wikt:Aut(E ,
wikt:sc(q) ,
wikt:ad(q) ,
wikt:SL(n ,
wikt:PGL(n ,
wikt:PSL(n ,
wikt:sc(q) ,
wikt:ad(q) ,
wikt:ad(q) ,
wikt:sc(q) ,
wikt:ad(q) ,
wikt:sc(q) ,
wikt:ad(q) ,
wikt:sc(q) ,
wikt:ad(q) ,
wikt:ad(q) : parts of mathematical formulas.
Ira Leviton (
talk ) 03:14, 13 September 2020 (UTC)
reply
1 -
Early modern glass in England -
wikt:rochetta : a type of plant.
Ira Leviton (
talk ) 20:07, 12 September 2020 (UTC)
reply
2 -
Earth mover's distance -
wikt:x1,m1 ,
wikt:xn,mn : mathematical formulas.
Ira Leviton (
talk ) 20:07, 12 September 2020 (UTC)
reply
3 -
Edwards curve -
wikt:x1,y1 ,
wikt:x2,y2 ,
wikt:x3,y3 : parts of mathematical formulas.
Ira Leviton (
talk ) 16:12, 13 September 2020 (UTC)
reply
5 -
Egorov's theorem -
wikt:A0,m0 ,
wikt:A1,m1 ,
wikt:d(f ,
wikt:fm(x) ,
wikt:fm(x) : parts of mathematical formulas.
Ira Leviton (
talk ) 16:12, 13 September 2020 (UTC)
reply
1 -
Ekplexite -
wikt:fenitic ,
wikt:kaskasite : geology terms.
Ira Leviton (
talk ) 16:12, 13 September 2020 (UTC)
reply
3 -
Elastin-like polypeptides -
wikt:ΔTt,fusion ,
wikt:ΔTt,fusion ,
wikt:VPGXG)n : parts of mathematical formulas.
Ira Leviton (
talk ) 16:12, 13 September 2020 (UTC)
reply
1 -
Electrocyclic reaction -
wikt:cis,trans : part of a chemical formula.
Ira Leviton (
talk ) 21:51, 13 September 2020 (UTC)
reply
6 -
Electron scattering -
wikt:q1,q2 ,
wikt:electron(s) ,
wikt:electron(s) ,
wikt:accelerator(s) ,
wikt:ring(s) : done deliberately to show singular and plural.
Ira Leviton (
talk ) 21:51, 13 September 2020 (UTC)
reply
8 -
Electronic band structure -
wikt:b1,b2 ,
wikt:m1,m2 ,
wikt:En(k) ,
wikt:En(k) ,
wikt:g(E) ,
wikt:g(E) ,
wikt:g(E) ,
wikt:V(r) : parts of mathematical formulas.
Ira Leviton (
talk ) 21:51, 13 September 2020 (UTC)
reply
1 -
Ellipsis (linguistics) -
wikt:Monday,she : showing a linguistic form, without a space.
Ira Leviton (
talk ) 21:51, 13 September 2020 (UTC)
reply
1 -
Elliptical distribution -
wikt:x1,x2 : mathematical formula.
Ira Leviton (
talk ) 21:51, 13 September 2020 (UTC)
reply
3 -
English plurals -
wikt:e)n ,
wikt:ax(e) ,
wikt:apple(s) : showing English grammar.
Ira Leviton (
talk ) 00:36, 16 September 2020 (UTC)
reply
1 -
Enterobactin -
wikt:Kf,Fe3 : part of a mathematical formula.
Ira Leviton (
talk ) 00:36, 16 September 2020 (UTC)
reply
1 -
Enterprise Architect (software) -
wikt:of .emx : a software file suffix.
Ira Leviton (
talk ) 00:36, 16 September 2020 (UTC)
reply
22 -
Envelope (mathematics) -
wikt:x0,y0 ,
wikt:t0,t02 ,
wikt:ft(x ,
wikt:F(t ,
wikt:ft(x ,
wikt:F(t ,
wikt:F(t ,
wikt:F(t ,
wikt:u(x ,
wikt:y)cos ,
wikt:v(x ,
wikt:y)sin ,
wikt:w(x ,
wikt:t)x ,
wikt:F(x ,
wikt:F(x ,
wikt:F(x ,
wikt:u(x ,
wikt:u(x ,
wikt:v(x) ,
wikt:u(x ,
wikt:q(t) : parts of mathematical formulas.
Ira Leviton (
talk ) 00:36, 16 September 2020 (UTC)
reply
3 -
Equipartition theorem -
wikt:qj,pj ,
wikt:U(r) ,
wikt:M(r) : mathematical formulas.
Ira Leviton (
talk ) 00:36, 16 September 2020 (UTC)
reply
1 -
Equivalence number method -
wikt:ηel,ref :mathematical formula.
Ira Leviton (
talk ) 00:36, 16 September 2020 (UTC)
reply
8 -
Equivalence of categories -
wikt:c1,c2 ,
wikt:Fc1,Fc2 ,
wikt:c1,c2 ,
wikt:Fc1,Fc2 ,
wikt:HomC(c ,
wikt:HomD(Fc ,
wikt:HomC(c ,
wikt:HomD(Fc : parts of mathematical formulas.
Ira Leviton (
talk ) 00:36, 16 September 2020 (UTC)
reply
26 -
Equivalent definitions of mathematical structures -
wikt:x1,x2 ,
wikt:S(n) ,
wikt:S(n) ,
wikt:signature(s) ,
wikt:P(X) ,
wikt:P(P ,
wikt:P(P ,
wikt:P(A) ,
wikt:P(N ,
wikt:P(N ,
wikt:P(N ,
wikt:P(N ,
wikt:P(X) ,
wikt:P(P ,
wikt:P(P ,
wikt:P(P ,
wikt:f(x ,
wikt:f(x ,
wikt:P(X) ,
wikt:f(A) ,
wikt:P(P ,
wikt:P(P ,
wikt:F(f) ,
wikt:P(SX) ,
wikt:set(s) ,
wikt:S(an) : parts of mathematical formulas.
Ira Leviton (
talk ) 00:36, 16 September 2020 (UTC)
reply
1 -
Erdős–Szekeres theorem -
wikt:ai,bi : part of a mathematical formula.
Ira Leviton (
talk ) 20:25, 17 September 2020 (UTC)
reply
1 -
Ettringite -
wikt:hycarbonate : part of a chemical name.
Ira Leviton (
talk ) 20:25, 17 September 2020 (UTC)
reply
12 -
Examples of vector spaces -
wikt:Fn,Fm ,
wikt:T(ei) , F[x], F[x], F[x], F[x], F[x,
wikt:L(V ,
wikt:L(V ,
wikt:L(Fn ,
wikt:L(V ,
wikt:Fq)n : parts of mathematical notations.
Ira Leviton (
talk ) 17:33, 18 September 2020 (UTC)
reply
4 -
Existentially closed model -
wikt:xn,y1 ,
wikt:xn,b1 ,
wikt:xn,b1 ,
wikt:an,b1 : parts of mathematical notations.
Ira Leviton (
talk ) 17:33, 18 September 2020 (UTC)
reply
4 -
Experix -
wikt:backslash,slash ,
wikt:sin(j ,
wikt:c .sin : software instructions.
Ira Leviton (
talk ) 17:33, 18 September 2020 (UTC)
reply
9 -
Exponential polynomial -
wikt:xn,ex1 ,
wikt:P(x , C[x,
wikt:P(x , K[X],
wikt:exp(wiX) ,
wikt:exp(u ,
wikt:exp(u) ,
wikt:exp(v) : mathematical notations.
Ira Leviton (
talk ) 17:33, 18 September 2020 (UTC)
reply
20 -
Exterior algebra -
wikt:v1,v2 ,
wikt:k(V) ,
wikt:k(V) ,
wikt:k(V) ,
wikt:T(M) ,
wikt:k(V) ,
wikt:n(V) ,
wikt:k(V) ,
wikt:k(f) ,
wikt:n(f) ,
wikt:k(V) ,
wikt:T(V) ,
wikt:T(V) ,
wikt:Tr(V) ,
wikt:T(V) ,
wikt:Alt(T ,
wikt:A(V) ,
wikt:T(V) ,
wikt:T(V) ,
wikt:Grk(V) : parts of mathematical notations.
Ira Leviton (
talk ) 17:33, 18 September 2020 (UTC)
reply
2 -
ECPG -
wikt:a .pgc ,
wikt:The .pcg : software file suffix.
Ira Leviton (
talk ) 15:03, 12 September 2020 (UTC)
reply
1 -
EGG (file format) -
wikt:placing .volX : software file suffix.
Ira Leviton (
talk ) 15:03, 12 September 2020 (UTC)
reply
1 -
EPSXe -
wikt:in .ppf : software file suffix.
Ira Leviton (
talk ) 15:03, 12 September 2020 (UTC)
reply
2 -
EPUB -
wikt:the .ncx ,
wikt:example .ncx : software file suffixes.
Ira Leviton (
talk ) 15:03, 12 September 2020 (UTC)
reply
1 -
ESP -
wikt:the .ESP , this is correct, name of a file format.
1 -
EULUMDAT -
wikt:is .ldt : software file suffix.
Ira Leviton (
talk ) 15:03, 12 September 2020 (UTC)
reply
2 -
Edraw Max -
wikt:The .edx ,
wikt:The .edxz : software file suffixes.
Ira Leviton (
talk ) 15:03, 12 September 2020 (UTC)
reply
1 -
Electronic publishing -
wikt:is .folio : software file suffix.
Ira Leviton (
talk ) 15:03, 12 September 2020 (UTC)
reply
3 -
Endianness -
wikt:MATLAB .mat ,
wikt:the .bil : software fil extensions.
2 -
Engineered Software Inc. -
wikt:extension .pipe ,
wikt:a .psv : software file extensions.
Ira Leviton (
talk ) 16:15, 12 September 2020 (UTC)
reply
1 -
Esther Raab -
wikt:ראב ,ילקוט : this is correct in Hebrew.
Ira Leviton (
talk ) 16:15, 12 September 2020 (UTC)
reply
1 -
Extensible Metadata Platform -
wikt:external .xmp : software file extension.
Ira Leviton (
talk ) 16:15, 12 September 2020 (UTC)
reply
TS+COMMA+
5 -
EbXML -
wikt:bi,eks : showing a pronunciation. I'm not sure if it was done according to WP policy, though.
Ira Leviton (
talk ) 19:06, 21 March 2020 (UTC)
reply
1 -
Ecdysone 20-monooxygenase -
wikt:Ecdysone,hydrogen : part of an enzyme name, no space after the comma.
Ira Leviton (
talk ) 19:06, 21 March 2020 (UTC)
reply
2 -
Ectoine -
wikt:L-2,4-diaminobutyric ,
wikt:L-2,4-diaminobutyric : chemical name.
Ira Leviton (
talk ) 19:06, 21 March 2020 (UTC)
reply
1 -
Elke (song) -
wikt:you : in a song title.
Ira Leviton (
talk ) 16:07, 23 March 2020 (UTC)
reply
2 -
Endomicroscopy -
wikt:µm ,
wikt:toumous - don't know how to fix the first one, and second might be okay
Strickesel (
talk ) - perhaps spell out "micrometers"?
Carla.Abra (
talk )
1 -
Enhanced vegetation index -
wikt:red,NIR - computational science notation
Strickesel (
talk )
2 -
Enoyl-(acyl-carrier-protein) reductase (NADPH, A-specific) -
wikt:trans-2,3-dehydroacyl ,
wikt:trans-2,3-dehydroacyl - chemistry notation
Strickesel (
talk )
2 -
Enoyl-(acyl-carrier-protein) reductase (NADPH, B-specific) -
wikt:trans-2,3-dehydroacyl ,
wikt:trans-2,3-dehydroacyl - chemistry notation
Strickesel (
talk )
1 -
Ent-cassa-12,15-diene 11-hydroxylase -
wikt:ent-11beta-hydroxycassa-12,15-diene - chemistry notation
Strickesel (
talk )
14 -
EnvZ/OmpR two-component system -
wikt:ompC ,
wikt:ompF ,
wikt:ompF ,
wikt:ompC ,
wikt:ompF ,
wikt:ompC ,
wikt:ompF ,
wikt:ompC ,
wikt:ompC ,
wikt:ompF ,
wikt:ompF ,
wikt:ompF ,
wikt:ompC ,
wikt:ompF - all some kind of chemical notation
Strickesel (
talk )
3 -
Epistolary novel -
wikt:13¾ ,
wikt:373⁄4 - part of book titles
Strickesel (
talk )
4 -
Ethernet Ring Protection Switching -
wikt:NR,RB ,
wikt:APS(SF ,
wikt:APS(NR ,
wikt:APS(NR - computational science notations
Strickesel (
talk )
1 -
Ethylmethylthiambutene -
wikt:N-ethyl-N-methyl-1-methyl-3,3-di-2-thienylallylamine - chemistry notation
1 -
Eucalyptus microtheca -
wikt:globulol - chemistry term
Strickesel (
talk )
1 -
Every Man in His Humour -
wikt:IV,iv - i think it's correct like that
Strickesel (
talk )
1 -
Every Man out of His Humour -
wikt:III,ii - i think it's correct like that
Strickesel (
talk )
TS+BRACKET+
1 -
E2F1 - promoter[PAX8 - chemistry notation
Strickesel (
talk )
3 -
E8 (mathematics) -
wikt:Spin(16 ,
wikt:so(16 ,
wikt:spin(16 - mathematical notation
Strickesel (
talk )
1 -
ECL (data-centric programming language) -
wikt:OUTPUT(SD - computational science notation
Strickesel (
talk )
1 -
ECU'92 -
wikt:in)directly - probably correct
Strickesel (
talk )
1 -
EDePro -
wikt:R60M(MK - part of a name
Strickesel (
talk )
1 -
EF50 -
wikt:PO)VT - part of a name
Strickesel (
talk )
1 -
EFCBP2 -
wikt:tm1a(KOMP - chemistry notation
Strickesel (
talk )
2 -
EGLN1 -
wikt:iron(II ,
wikt:iron(II - chemistry notation
Strickesel (
talk )
1 -
EHA101 -
wikt:A136(pTiBo542 - chemistry notation
Strickesel (
talk )
1 -
EHNA -
wikt:nonyl)adenine - chemistry notation
Strickesel (
talk )
1 -
EIF2C1 -
wikt:tm1a(KOMP - chemistry notation
Strickesel (
talk )
1 -
EIF4E3 -
wikt:tm1a(KOMP - chemistry notation
Strickesel (
talk )
1 -
ELAM 5 Combate Ceja del Negro -
wikt:studies(prep
1 -
ENC1 -
wikt:tm1a(EUCOMM - chemistry notation
Strickesel (
talk )
2 -
ENDOG -
wikt:poly(dG ,
wikt:poly(dC - chemistry notation
Strickesel (
talk )
1 -
ENO3 -
wikt:rich)6GG - chemistry (?) notation
Strickesel (
talk )
1 -
ENTPD6 -
wikt:tm1a(KOMP - chemistry notation
Strickesel (
talk )
2 -
EPA list of extremely hazardous substances -
wikt:yl)Methylene ,
wikt:Decaborane(14 - chemistry notation
Strickesel (
talk )
1 -
EPS15 -
wikt:tm1a(KOMP - chemistry notation
Strickesel (
talk )
3 -
ERCC5 -
wikt:Ercc5(Xpg ,
wikt:Ercc5(Xpg ,
wikt:Ercc5(Xpg - chemistry notation
Strickesel (
talk )
4 -
ERCC6 -
wikt:CSA(ERCC8 ,
wikt:CSB(ERCC6 ,
wikt:CSB(ERCC6 ,
wikt:SNM1A(DCLRE1A - chemistry notation
Strickesel (
talk )
2 -
ERCC8 (gene) -
wikt:CSA(ERCC8 ,
wikt:CSB(ERCC6 - chemistry notation
Strickesel (
talk )
1 -
ERLIN2 -
wikt:tm1a(EUCOMM - chemistry notation
Strickesel (
talk )
1 -
ESA CAVES -
wikt:cavenauts - apparently a real word
Strickesel (
talk )
1 -
ETFE -
wikt:poly(ethene - chemistry notation
Strickesel (
talk )
1 -
EVI5 -
wikt:tm1a(KOMP - chemistry notation
Strickesel (
talk )
1 -
EXOC3L2 -
wikt:tm1b(KOMP - chemistry notation
Strickesel (
talk )
1 -
Earl of Devon -
wikt:Devon(iae : written deliberately, Latin.
Ira Leviton (
talk ) 23:05, 28 March 2020 (UTC)
reply
2 -
Earthtone9 -
wikt:def(inition : part of the name of a record album.
Ira Leviton (
talk ) 23:05, 28 March 2020 (UTC)
reply
4 -
East Bengal State Acquisition and Tenancy Act of 1950 -
wikt:rajasva ,
wikt:rajasva ,
wikt:rajasva ,
wikt:rajasva ,
wikt:rajasva : I tagged the first instance with the 'which lang' tag.
Ira Leviton (
talk ) 17:00, 27 March 2020 (UTC)
reply
8 -
East Strickland languages -
wikt:da)subu ,
wikt:mere(ma ,
wikt:da)suf ,
wikt:fulu(ma (probably OK:
wikt:pTNG ,
wikt:maŋgat ,
wikt:korofu ,
wikt:ŋg ): all trying to show transcribed words.
Ira Leviton (
talk ) 17:00, 27 March 2020 (UTC)
reply
1 -
Eastern Slovak Hills -
wikt:East(ern : written deliberately.
Ira Leviton (
talk ) 17:00, 27 March 2020 (UTC) // this would be fine elsewhere in text, but I'm not sure if we're allowed to do that in the bolded part of the first sentence. --
Xurizuri (
talk ) 10:01, 31 January 2021 (UTC)
reply
1 -
Eastern Sudanic languages -
wikt:ko)TVS : trying to show some type of foreign word.
Ira Leviton (
talk ) 17:00, 27 March 2020 (UTC)
reply
2 -
Eastern Trans-Fly languages -
wikt:ka)mu ,
wikt:ka)mi ,
wikt:you : showing language.
Ira Leviton (
talk ) 23:05, 28 March 2020 (UTC)
reply
1 -
Ecological art -
wikt:Environ)Mental : part of the name of an artwork.
Ira Leviton (
talk ) 17:45, 28 March 2020 (UTC)
reply
4 -
Edfor -
wikt:ED)uardo ,
wikt:OR)ge ,
wikt:uardo : all explaining word origins.
Ira Leviton (
talk ) 18:54, 28 March 2020 (UTC)
reply
1 -
Edge recombination operator -
wikt:length(Parent : software jargon.
Ira Leviton (
talk ) 18:54, 28 March 2020 (UTC)
reply
2 -
Edith Humphrey -
wikt:dinitrocobalt(III : chemistry notation.
Ira Leviton (
talk ) 18:54, 28 March 2020 (UTC)
reply
1 -
Edmonds–Karp algorithm - graph[cur: part of software code.
Ira Leviton (
talk ) 18:54, 28 March 2020 (UTC)
reply
1 -
Edward I. Solomon -
wikt:Hydroxy)mandelate : part of a chemical name.
Ira Leviton (
talk ) 00:29, 30 March 2020 (UTC)
reply
1 -
Edward J. Bloustein School of Planning and Public Policy -
wikt:geoprocessioning : looks legit.
Ira Leviton (
talk ) 00:29, 30 March 2020 (UTC)
reply
1 -
Elassovalene - cyclopent[cd: part of a chemical name.
Ira Leviton (
talk ) 21:14, 31 March 2020 (UTC)
reply
1 -
Electroluminescence -
wikt:Ru(bpy : chemistry notation.
Ira Leviton (
talk ) 15:46, 3 April 2020 (UTC)
reply
2 -
Electron beam-induced deposition -
wikt:Me(CO : chemistry notation.
Ira Leviton (
talk ) 15:46, 3 April 2020 (UTC)
reply
2 -
Electron-transferring-flavoprotein dehydrogenase -
wikt:QO(red ,
wikt:QO(ox : chemistry notation.
Ira Leviton (
talk ) 15:46, 3 April 2020 (UTC)
reply
2 -
Electronic Saviors: Industrial Music To Cure Cancer - Rein[Forced, Rein[Forced: the name of an album.
1 -
Elias Arnér -
wikt:In)Visible : the name of an artwork.
Ira Leviton (
talk ) 22:01, 3 April 2020 (UTC)
reply
1 -
Eliashib (High Priest) -
wikt:grand)father : written deliberately.
Ira Leviton (
talk ) 22:01, 3 April 2020 (UTC)
reply
1 -
Elizabeth (1809 Bristol ship) -
wikt:Ne(illegible : written deliberately.
Ira Leviton (
talk ) 22:01, 3 April 2020 (UTC)
reply
1 -
Elizabeth Morton -
wikt:Five(ish : part of the name of a TV program.
Ira Leviton (
talk ) 22:01, 3 April 2020 (UTC)
reply
1 -
Elizabeth de Portzamparc -
wikt:Re)Construire : the name of a project.
Ira Leviton (
talk ) 22:01, 3 April 2020 (UTC)
reply
Elnathan John -
wikt:Be(com - Be(com)ing Nigerian, book title
Emanuel syndrome -
wikt:der(22 ,
wikt:der(22 ,
wikt:der(22 ,
wikt:der(22 ,
wikt:der(22 ,
wikt:der(22 - derivative 22 syndrome, or der(22) syndrome // it's an alt name for the article, so a redirect is probably the best fix (will that fix this or do the parentheses mess it up?). --
Xurizuri (
talk ) 10:01, 31 January 2021 (UTC)
reply
1 -
Emma L. E. Rees -
wikt:Dis)ease - (Dis)ease, part of a book chapter title
1 -
Enconcept E-Academy -
wikt:memolodies : a made-up word.
Ira Leviton (
talk ) 17:59, 4 April 2020 (UTC)
reply
3 -
Endo-alpha-sialidase -
wikt:poly(alpha ,
wikt:poly(alpha ,
wikt:poly(sialic : chemistry notations.
Ira Leviton (
talk ) 17:59, 4 April 2020 (UTC)
reply
1 -
Endomorphin-2 - Met]enkephalin: chemistry notation.
Ira Leviton (
talk ) 17:59, 4 April 2020 (UTC)
reply
6 -
Endoscopic endonasal surgery -
wikt:transplanum ,
wikt:subchiasmatic : medical/anatomic jargon.
Ira Leviton (
talk ) 17:59, 4 April 2020 (UTC)
reply
2 -
Endothion -
wikt:YL)METHYL ,
wikt:YL)METHYL : chemistry jargon.
Ira Leviton (
talk ) 17:59, 4 April 2020 (UTC)
reply
1 -
Engelhardt family -
wikt:stolniks - a real word
Strickesel (
talk )
1 -
Enigmata -
wikt:hexa)metrical - probably correct
Strickesel (
talk )
1 -
Enol -
wikt:RC(OH - chemistry notation
Strickesel (
talk )
1 -
Enriques surface -
wikt:super)singular - probably correct
Strickesel (
talk )
1 -
Environmentally-friendly red light flare -
wikt:poly(vinyl - chemistry notation
Strickesel (
talk )
1 -
Eousdryosaurus -
wikt:SHN(JJS - part of a name
Strickesel (
talk )
1 -
Ephrin A1 -
wikt:tm1a(EUCOMM - chemistry notation
Strickesel (
talk )
1 -
Epps - piperazinyl]propanesulfonic - chemistry notation
Strickesel (
talk )
1 -
Epristeride -
wikt:butylcarbamoyl)androsta - chemistry notation
Strickesel (
talk )
1 -
Equicontinuity -
wikt:arctan(nx - mathematical notation
Strickesel (
talk )
1 -
Equizetum -
wikt:Equizeten(sis - latin
Strickesel (
talk )
2 -
Erechtheis - Ph[ryni, Ph[ryni - two versions of a greek name
Strickesel (
talk )
2 -
Eric Chasalow -
wikt:Cinta)mani ,
wikt:Cinta)mani - part of a title
Strickesel (
talk )
1 -
Ericssonite - FeO[Si - chemistry notation
Strickesel (
talk )
2 -
Erika Rothenberg -
wikt:Un)Fame ,
wikt:Un(Fame - title
Strickesel (
talk )
2 -
Eritrean Catholic Archeparchy of Asmara -
wikt:Asmaren(sis ,
wikt:Asmaren(sis - latin
Strickesel (
talk )
2 -
Ermenek -
wikt:Basil(eus ,
wikt:Germanicopolitan(us - latin names
Strickesel (
talk )
1 -
Erondu–Cymet syndrome -
wikt:inv(21 - probably correct
Strickesel (
talk )
2 -
Erythrosine - spiro[3H, Spiro[isobenzofuran - chemistry notation
Strickesel (
talk )
1 -
Erythrum -
wikt:Erythritan(us - Latin word
Strickesel (
talk )
1 -
Essays in French Literature and Culture -
wikt:Re)sist - part of a title
Strickesel (
talk )
2 -
Ester -
wikt:RC(OR ,
wikt:Poly(ethylene - chemistry notation
Strickesel (
talk )
1 -
Estriol succinate -
wikt:di(hydrogen - chemistry notation
Strickesel (
talk )
1 -
Eteplirsen - CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG - probably correct chemistry notation
Strickesel (
talk )
2 -
Ethanethiol -
wikt:Hg(SEt ,
wikt:Ni(SEt - chemistry notation
Strickesel (
talk )
1 -
Ethenolysis -
wikt:Rhenium(VII - chemistry notation
Strickesel (
talk )
1 -
Ethyl cyanoacetate -
wikt:cobalt(II - chemistry notation
Strickesel (
talk )
2 -
Ethyl vinyl ether -
wikt:EtOCH(OR ,
wikt:EtOC(Li - chemistry notation
Strickesel (
talk )
1 -
Ethylenediaminediacetic acid - Na[Co - chemistry notation
Strickesel (
talk )
2 -
Ethylisopropyltryptamine -
wikt:yl)ethyl - chemistry notation
Strickesel (
talk )
1 -
Ethylmercury -
wikt:mercury(II - chemistry notation
Strickesel (
talk )
6 -
EuFOD -
wikt:Eu(fod ,
wikt:Eu(fod ,
wikt:Eu(fod ,
wikt:Eu(DPM ,
wikt:Eu(fod ,
wikt:Eu(fod - chemistry notation
Strickesel (
talk )
1 -
Eudesmic acid -
wikt:yl)benzamide - chemistry notation
Strickesel (
talk )
1 -
Eugen Kölbing -
wikt:German(ic - German(ic) Literature
Strickesel (
talk )
1 -
Eugène-Melchior Péligot -
wikt:chromium(II - chemistry notation
Strickesel (
talk )
1 -
Euler pseudoprime -
wikt:if(modPow - computational science notation
Strickesel (
talk )
1 -
European League of Institutes of the Arts -
wikt:inter)national - (inter)national
Strickesel (
talk )
1 -
European Technology Exposure Facility -
wikt:Flux(Phi - part of a name
Strickesel (
talk )
1 -
Europium(III) chloride -
wikt:LiN(SiMe - chemistry notation
Strickesel (
talk )
1 -
Evangelical People's Party (Netherlands) -
wikt:destalinised - seems correct
Strickesel (
talk )
1 -
Exiliboa - [[wikt:B1ab(iii] - a name
Strickesel (
talk )
1 -
Exo Planet 3 – The Exo'rdium (dot) - rDIUM[dot - stylized version of this album name
Strickesel (
talk )
1 -
Exotic hadron -
wikt:Zc(3900 - name of a Hadron candidate
Strickesel (
talk )
3 -
Exp algebra -
wikt:exp(gt ,
wikt:exp(gt ,
wikt:exp(gt - mathematical notation
Strickesel (
talk )
2 -
Expected value of including uncertainty -
wikt:LogNormal(median ,
wikt:LogNormal(median - computational science notation
Strickesel (
talk )
3 -
Expectiminimax -
wikt:expectiminimax(child , Probability[child,
wikt:expectiminimax(child - computational science notation
Strickesel (
talk )
4 -
Expert system -
wikt:Man(Socrates ,
wikt:Mortal(Socrates ,
wikt:Mortal(Socrates ,
wikt:Man(Socrates - computational science notation
Strickesel (
talk )
3 -
Extensions to the International Phonetic Alphabet -
wikt:de)voiced ,
wikt:de)voicing ,
wikt:denasals - all correct
Strickesel (
talk )
1 -
Exterior (topology) -
wikt:ext(ext - mathematical notation
Strickesel (
talk )
1 -
Extra(ordinary) People -
wikt:Extra(ordinary - Extra(ordinary), part of the title
Strickesel (
talk )
1 -
Eye2eye Software - inter]national - written intentionally as [inter]national
Strickesel (
talk )
1 -
Ezzedine Salim -
wikt:Ali(as - probably intended to be written as Ali(as)
Strickesel (
talk )
T2+
E.-Edo
Ei-Elg
Ei mechanism - (probably OK:
wikt:phenylsulfoxides ) - unclear, "phenyl sulfoxide" has more Google results than "phenylsulfoxide"
Eidyn -
wikt:cinbin - cinbin (dogheads)
Eilne -
wikt:nEilne ,
wikt:nEilne - alias Mag nEilne
Eimeriorina -
wikt:homoxenous ,
wikt:homoxenous - medical term
Ein Heller und ein Batzen -
wikt:heido - under the name “Heidi, heido, heida” (based on the refrain)
Einstein aether theory -
wikt:aetheory - Einstein aether theory, also called aetheory
Ekatarina Velika - (probably OK:
wikt:bienalle ) - capitalized Bienalle, not 100% sure
Eko Eko Azarak -
wikt:cabyolas - part of Eko Eko chant
El Dorado, Arkansas -
wikt:octunda - architectural term
El Mamey Formation -
wikt:dommeli - Sphaerodactylus dommeli / S. dommeli
El Palmar CF -
wikt:vinculation - Verb. vinculate. (rare) To tie or bind. (arithmetic) To calculate a vinculum.
El puñao de rosas -
wikt:culminative ,
wikt:tanguillo ,
wikt:chiquiya all OK
El-Abry Museum for Heritage and Classic Cars -
wikt:jusah - jusah (storage compartment for dates)
Elachistosuchus -
wikt:souchos - souchos , an Egyptian crocodile god
Elai Lineendunge -
wikt:hikwa -
hikwa
Elaine Nile -
wikt:comptometrist -
comptometrist
Elaver -
wikt:orvillei - Elaver orvillei (Chickering, 1937) — Panama
Elbe Marshes -
wikt:polderland - region of
marsh or
polderland
Eldana -
wikt:saccharrina ,
wikt:stemmator - African sugar-cane borer (Eldana saccharina ); Xanthopimpla stemmator
Elections in Bhutan -
wikt:zomdu ,
wikt:kabneys - democratic election called a zomdu ;
kabneys
Electric Picnic 2008 -
wikt:myhabs (probably OK:
wikt:myhab ) - Myhab eco-friendly alternative to camping
Electric Warrior (comics) -
wikt:primmie - tribe of natural born natives called Primmies.
Electron crystallography -
wikt:undiffracted - OK
Electronic Visualization Laboratory -
wikt:augmentics - OK; (not OK:
wikt:jonCates , should be Jon Cates)
Electronic circuit -
wikt:perfboards -
perfboards
Elegant pitta -
wikt:hutzi - P. e. hutzi
Meise , 1942 – island of
Nusa Penida (southeast of
Bali )
Eleutherobia -
wikt:imaharai (probably OK:
wikt:vinadigitaria ) - * Eleutherobia imaharai Bryce, Poliseno, Alderslade & Vargas, 2015
Es-Et
Euc-Eó
1 -
Eucithara bascauda -
wikt:fimbriolate - seems correct
Strickesel (
talk )
1 -
Eucithara diaglypha -
wikt:costulae - seems correct
Strickesel (
talk )
1 -
Eucithara elegans -
wikt:elevately - adj for elevate, might be okay
Strickesel (
talk )
2 -
Eucithara lepidella -
wikt:costulae ,
wikt:costulae - seems correct
Strickesel (
talk )
1 -
Eucithara solida -
wikt:granosely - might be okay?
Strickesel (
talk )
2 -
Eufunction -
wikt:eufunctions ,
wikt:eufunctions - plural of the title page name
Strickesel (
talk )
1 -
Eulimella scillae -
wikt:subangulated - a real word
Strickesel (
talk )
1 -
Eumel -
wikt:oimel - a pronounciaton "guide"
Strickesel (
talk )
1 -
Euphalacra trifenestrata -
wikt:postraedial - not correct, but don't know the correct spelling
Strickesel (
talk )
1 -
European Business Aviation Association -
wikt:aeropolitical - seems okay
Strickesel (
talk )
2 -
European hornet -
wikt:vespines ,
wikt:vespines - latin name
Strickesel (
talk )
2 -
Eurybia (plant) -
wikt:scabrellous ,
wikt:epaleate - both are real words, it seems
Strickesel (
talk )
1 -
Eurybotas -
wikt:toxarch - not sure if okay
Strickesel (
talk )
3 -
Eusebius Fermendžin -
wikt:potssimum ,
wikt:eccelesiastica - latin
Strickesel (
talk )
1 -
Euspira nitida -
wikt:undeep - might be okay
Strickesel (
talk )
3 -
Eustache le Peintre de Reims -
wikt:he's ,
wikt:porroie ,
wikt:mestroie - Eustache's; french
Strickesel (
talk )
1 -
Evan Rosen -
wikt:collabicate - means "collaborate and communicate"
Strickesel (
talk )
1 -
Evan Winiker -
wikt:sirenXX - a musician/band
Strickesel (
talk )
1 -
Evangelical Church of the Augsburg Confession in Poland -
wikt:deaconic - seems to be a real word
Strickesel (
talk )
1 -
Evangelical Church of the Augsburg Confession in Slovakia -
wikt:seniorats - unsure if ok
Strickesel (
talk )
1 -
Even Sapir -
wikt:repatriants - seems to be a real word
Strickesel (
talk )
1 -
Evening Telegraph (Dublin) -
wikt:unavowedly - a real word
Strickesel (
talk )
1 -
Evergreen State College -
wikt:demeters - probably okay
Strickesel (
talk )
3 -
Evolution Theory (Modestep album) -
wikt:xKore ,
wikt:xKore ,
wikt:xKore - name of a musician (I think)
Strickesel (
talk )
1 -
Ewen McQueen -
wikt:renewnz - the name of a blogging website
Strickesel (
talk )
1 -
Ex-Cubs Factor -
wikt:cubness - seems to be okay
Strickesel (
talk )
2 -
Excideuil -
wikt:ialo ,
wikt:francicarum - celtic; latin
Strickesel (
talk )
1 -
Excited and Scared -
wikt:how's - show's
Strickesel (
talk )
2 -
Exergonic process -
wikt:ergonic ,
wikt:endergon - suffix; seems to be okay
Strickesel (
talk )
3 -
Exhibition of Australian Art in London -
wikt:it's ,
wikt:how's ,
wikt:airists - piquenit's; show's; apparantly a real word
Strickesel (
talk )
1 -
Existenz -
wikt:transCendenZ - a video game in this game
Strickesel (
talk )
1 -
Exocarpos aphyllus -
wikt:dtulya - noongar, indigenous australian
Strickesel (
talk ) // iso code nys --
Xurizuri (
talk ) 09:26, 31 January 2021 (UTC)
reply
1 -
Exodus of Kashmiri Hindus -
wikt:khatrey - some kind of indian
Strickesel (
talk )
1 -
Exomilus pentagonalis -
wikt:excavately - might be okay
Strickesel (
talk )
1 -
Exomilus telescopialis -
wikt:excavately - might be okay
Strickesel (
talk )
1 -
Exotic felids as pets -
wikt:caracats - a species name
Strickesel (
talk ) // more specifically, caracats are crossbreeds between caracals (wild) and Abyssinians (domesticated). It's not mentioned in either of those articles, or I'd suggest making a redirect. --
Xurizuri (
talk ) 09:48, 21 January 2021 (UTC)
reply
1 -
ExpanDrive -
wikt:hubiC - a brand name
Strickesel (
talk )
1 -
Exploration Systems Architecture Study -
wikt:hypergolics - seems to be a real word
Strickesel (
talk )
1 -
Exponential random graph models -
wikt:undyadic - don't know enough about this to know if ok
Strickesel (
talk )
4 -
Extended metaphor -
wikt:pataphors ,
wikt:pataphors ,
wikt:pataphors ,
wikt:pataphorical - an "unusually extended metaphor"
Strickesel (
talk )
2 -
Extreme Rules (2009) -
wikt:how's ,
wikt:superplexed - show's; a wrestling maneuver with a link
Strickesel (
talk )
1 -
EyeToy: AntiGrav -
wikt:thonerers - a species in this series
Strickesel (
talk )
1 -
Eyes Wide Open (book) -
wikt:globaltl - a hashtag
Strickesel (
talk )
1 -
Eysturoy -
wikt:estroi - pronounciation of this article
Strickesel (
talk )
2 -
Ezboard -
wikt:ezboards ,
wikt:ezboards - the same as the name of this article
Strickesel (
talk )
1 -
Ezili Dantor -
wikt:insurrected - can't decide if this is okay or not
Strickesel (
talk )
2 -
Ezo red fox -
wikt:kimotpe ,
wikt:hurep - words in the language of the ainu, a group in northern japan
Strickesel (
talk )
1 -
Ezutromid -
wikt:nmDMD - seems to be an illness
Strickesel (
talk )
El-Er
2 -
E (Epik High album) -
wikt:nergy ,
wikt:nergy : as [e]nergy, the second side of the album.
1 -
E (novel) -
wikt:twatter : a word used in the novel to describe one of the characters, and correspondingly used in the article. I was thinking of deleting it because it's hard to figure out the meaning without context. // I've asked for clarification. --
Xurizuri (
talk ) 08:59, 22 January 2021 (UTC)
reply
1 -
ENC Press -
wikt:everance : title of a book, $everance.
1 -
Earthsea (universe) -
wikt:otaks : fictional character in the book (plural).
1 -
East Bakersfield -
wikt:deincorporated : dissolved as a corporation or city. Legit.
1 -
East Kilbride Pirates -
wikt:unkitted : I'm not sure, may be legit.
1 -
Eastern Air Lines Flight 605 -
wikt:unporting : disengagement of two pieces that go together, as in machinery or aviation.
42 -
Ego Trip's The (White) Rapper Show -
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock ,
wikt:hamrock : written as $hamrock.
1 -
Eldad and Medad -
wikt:daddu : translation of a corrupted Hebrew word for "beloved".
1 -
Electrical substation -
wikt:buswork : legit. Sometimes simply called "bus". A conductor, or group of conductors, that serve as a common connection for two or more electrical circuits. In powerplants, buswork comprises the three rigid single-phase connectors that interconnect the generator and the step-up transformers.
4 -
Electrodialysis -
wikt:diluate ,
wikt:diluate ,
wikt:diluate ,
wikt:diluate : probably legit. A chemical term. Akin to concentrate (noun). \\ it's similar to the solute/solvent situation, with diluate and diluent respectively.
[1] --
Xurizuri (
talk ) 10:41, 21 January 2021 (UTC)
reply
2 -
Electropalatography -
wikt:electropalates ,
wikt:electropalate : legitimate, in the context of the page.
2 -
Elemene -
wikt:elemenes ,
wikt:elemenes : plural of the subject of the page.
2 -
Elemental: Fallen Enchantress -
wikt:gildar ,
wikt:gildar : the unit of currency used in the game.
1 -
Elemental: War of Magic -
wikt:gildar : ditto.
1 -
Eliza Acton -
wikt:sparghetti : a deliberate misspelling of spaghetti.
1 -
Eliza Courtney -
wikt:sequested : I don't have access to the source and I'm not sure whether it was intentionally spelled this way as an old-fashioned spelling, or a typo.
1 -
Elk -
wikt:waapiti : the Shawnee and Cree spelling of wapiti,.
1 -
Elmo (shogi engine) -
wikt:ponanza : a name for a type of software.
2 -
Els Catarres -
wikt:xoni ,
wikt:xoni a young person in Catalunya who is culturally Castilian.
1 -
Elven Star -
wikt:tytans : a type of creature in the book.
2 -
Emblem of the Uzbek Soviet Socialist Republic -
wikt:uracle ,
wikt:uracle : a type of sickle.
3 -
Emergence (Star Trek: The Next Generation) -
wikt:vertion ,
wikt:vertion ,
wikt:vertion : a type of particle on Star Trek.
1 -
Emilio Pujol -
wikt:portrs : an abbreviation. (Portraits?)
1 -
Empress Dowager Xiaochun -
wikt:pitian : part of a Chinese title. Possibly should be capitalized.
1 -
Enclosure Services Interface -
wikt:deasserts : computer software jargon.
1 -
Endodontic files and reamers -
wikt:ledging : dental jargon.
1 -
English Springer Spaniel -
wikt:hupped : past tense of 'hup', a command given to a dog.
1 -
English overseas possessions in the Wars of the Three Kingdoms -
wikt:embezeled : a spelling from the 1600s.
1 -
Environmental movement in the United States -
wikt:antitoxics : subgroups that are affiliated with the environmental movement in the U.S.
1 -
Epilepsy surgery -
wikt:resective : a bit of medical jargon, referring to surgery that results in resection, cutting away, or removal.
1 -
Erin Gee (artist) -
wikt:sooe : in the title of an artwork (with a lower case s as written).
1 -
Eritrean literature -
wikt:melkes : plural for melke, an Eritrean word for a work written for funerals and praising the deceased
1 -
Ernest Maddox -
wikt:phorias : plural. Misalignment of the eyes that appears when binocular viewing is broken.
1 -
Etu -
wikt:sekas - non-English. Meaning something like 'referee' Asked for language on talk page. Don't want to assume Indonesian just because that's where the article's subject is practiced.
Elfabet (
talk )
1 -
Eulalia Abaitua Allende-Salazar -
wikt:dispens : seems to be part of her husband's name, not capitalized in
non-wiki source that I could find
1 -
Euprenolepis -
wikt:mandalus :
zoology term
1 -
Eupterote orientalis -
wikt:aenescent :
entomology term
1 -
Exaptation -
wikt:exapting - likely belongs, perhaps as 'exaptating' (cross of ex- and -adapting). Form of article's subject. Similar forms exist on wikt: e.g.
wikt:exaptation . -Can confirm this is a real thing
Carla.Abra (
talk )
1 -
Exit (system call) -
wikt:movl : part of sample code