![]() | Homologous recombination has been listed as one of the Natural sciences good articles under the good article criteria. If you can improve it further, please do so. If it no longer meets these criteria, you can reassess it. | ||||||||||||||||||||||||
|
![]() | This ![]() It is of interest to the following WikiProjects: | ||||||||||||||||
|
![]() | This article links to one or more target anchors that no longer exist.
Please help fix the broken anchors. You can remove this template after fixing the problems. |
Reporting errors |
The introduction does not actually say what HR is. ie. no summary explanation. —Preceding unsigned comment added by 99.234.154.88 ( talk) 19:33, 20 April 2009 (UTC)
I do not know how to add a reference, but would add "Molecular Biology of the Gene, Fifth Edition" by James D. Watson, et al. I started to add it, but it seemed like a mess, so I left it out.
I would add this article also: http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=18022364
It discusses how RecD appears only to be inactivated, not lost from the complex. It has some important information for the RecBCD articles, as well. —Preceding unsigned comment added by RegiG ( talk • contribs) 02:01, 1 July 2008 (UTC)
Hello, I have a few suggestions to help improve this article. First, though, big thanks to Emw2012 for all his recent work on this article. I've been watching these edits and the improvement is really remarkable! Here are my suggestions:
I will help with some of this if I get a chance. Amazinglarry ( talk) 02:29, 24 August 2009 (UTC)
"The World of the Cell", introductory book on Cell biology, ISBN 978-0-321-55418-5, Pearson/BenjaminCummings, mentions on page 627 five different situations in which hom. rec. occurs: 1) Two different phages infect the same bacterium 2) Uptake of raw DNA in bacteria (transformation) 3) Systematic transfer of genetic material (plasmids) between bacteria (conjugation) 4) Prophase I 5) Transfer of bacterial genes between bacteria by incorporation in virus (phage) (transduction). The present article mentions meiosis and mitosis. This seems rather incomplete. -- Ettrig ( talk) 07:19, 7 September 2009 (UTC)
The article currently says "Studies in several model bacteria ...". Is "model" valuable here? I think the normal use of "model" in contexts like these is used to signal that one really is interested in studying a mechanism in the human body, but studying the corresponding mechanism in another organism instead, in the hope that the mechanism in the other organism is sufficiently similar to the human one. This article is not specifically about human HR. -- Ettrig ( talk) 16:13, 10 September 2009 (UTC)
I find that model is used extensively in the article. I think this is because medical research is such a large part of melecular biology research. Possibly the meaning of this expression has changed in the modern context, from used to provide "insight into the workings of other organisms", as Model organism says, to used to provide insight into a particular mechanism, subsystem etc. But for the time being we should stick to the Wikipedia description of the concept. -- Ettrig ( talk) 16:23, 10 September 2009 (UTC)
I think that the section needs to be significantly streamlined, it has a lot of unnecessary information, and it doesn't have any sources for half the things it says. Gobbits ( talk) 07:02, 18 May 2015 (UTC)
For starters, this is a nice article! In the Protein Engineering section, we might consider adding links to DNA shuffling, RACHITT and other similar articles. However, those two articles I mentioned are in need of attention. Pdcook ( talk) 17:03, 18 September 2009 (UTC)
the intro says These new combinations of DNA produce genetic variation. This is grammatically wrong. The process of recombination produces genetic variation. The combinations themselves ARE the genetic variation. The article is so well formulated in general, that I dare not make the corrections myself. In my opinion it is overdue for the GA stamp. -- Ettrig ( talk) 16:00, 21 September 2009 (UTC)
Here are some comments on the article's prose:
Resolved comments
|
---|
|
I will add comments here as I go through the article. As you address issues, please respond beneath the individual concerns above so that I know which are done and which require further discussion. Thanks! --
Cryptic C62 ·
Talk
02:26, 24 June 2010 (UTC)
Review discontinued due to inactivity. If anyone is interested in continuing, feel free to leave a message on my talk page. -- Cryptic C62 · Talk 15:00, 23 August 2010 (UTC)
The lead generally does a very good job. I can't comment on whether it is comprehensive but it is fairly accessible to a lay reader. However, lead terms that may not be understood are: homologous, eukaryotes, protists, eukaryotic, conserved. If you can make those accessible, you stand a chance of keeping the reader beyond the lead!
History:
Once the reader gets past the lead, the first sentence he gets in the history is "Following the discoveries made by Gregor Mendel, it was shown that genes are often linked and do not segregate randomly." This is a bit off putting because it assumes the reader knows what "discoveries" Mendel made. The average reader will connect Mendel with genetics but this is a very advanced genetic topic so will wonder if there's some specific discovery they should know about. I think you need to explain "linked" and "segregate". The latter could also be linked to the appropriate bit in Mendelian inheritance perhaps.
The sentence "Thomas Hunt Morgan introduced the term "crossing over"" doesn't explain what he introduced the term for. It gives an explanation later in the sentence but says this was "shown later" which begs the question why he introduced the term if he didn't know what it meant.
This is such a complex subject that you might need to re-explain jargon that is already explained in the lead. So it probably does no harm to explain meiosis and you haven't yet explained mitosis.
Hans Winkler's "gene conversion" term is not defined. I'm beginning to wonder if the History can only be understood once you've read the article. The "Holliday junctions", "DSBR pathway" and "SDSA pathways" aspects won't really mean anything to the reader at this stage, so they can't really grasp why these discoveries are relevant.
I think the gene targeting sentence "In recognition...2007 Nobel Prize" belongs in this section, not the gene targeting section. I wonder also if some aspects of the cancer therapy is notable enough to appear in the history.
In eukaroytes:
You need to define "eukaroytes". My comments on explaining mitosis/meiosis may apply here if the History section is moved. Define "somatic cells".
The sentence "Chromosomal crossover begins when the Spo11 protein makes a..." is written with the assumption that the reader knows the Spo11 protien and is best friends with its brother. I'm guessing at this stage that I don't need to know much about Spo11 other than what it does here. You can help me feel less ignorant my saying "begins when a protein called Spo11 makes a...". I'm guessing that "programmed" means "deliberate"?
"1,000-2,000 base pair regions of chromosomes" I know what "base pairs" are (well, vaguely) but the general reader wont. They might not appreciate that this appears to be a description of the size of the regions. Should it be "in chromosomes"?
"by the phase of cell cycle" Ok I'm beginning to get lost. Can you give me a brief introduction to the "cell cycle" and the phases. The diagram on the right needs the key from Cell cycle otherwise it isn't telling me anything.
"Cyclin-dependent kinases (CDKs), which modify" I don't know what kinases are never mind Cyclin-dependent ones. Looking up WP, I see they are enzymes. Could we say something like "Homologous recombination in eukaryotes is regulated by cyclin-dependent kinases (CDKs), enzymes that modify the activity of other proteins by adding phosphate groups to them (known as phosphorylation)."
I don't know what "endonuclease activity" is. Or what the MRX complex is.
"a homolog of the bacterial RecQ helicase discussed above" The RecQ helicase is discussed below. So I can't follow this and I don't know what a helicase is.
Colin° Talk 20:37, 25 June 2010 (UTC)
This article has a dead link (ref 2) [1] MacDaid ( talk) 18:28, 26 June 2010 (UTC)
![]() |
An image used in this article,
File:RecBCD recomb model.tif, has been nominated for speedy deletion at
Wikimedia Commons for the following reason: Copyright violations
Don't panic; deletions can take a little longer at Commons than they do on Wikipedia. This gives you an opportunity to contest the deletion (although please review Commons guidelines before doing so). The best way to contest this form of deletion is by posting on the image talk page.
To take part in any discussion, or to review a more detailed deletion rationale please visit the relevant image page (File:RecBCD recomb model.tif) This is Bot placed notification, another user has nominated/tagged the image -- CommonsNotificationBot ( talk) 11:49, 27 March 2012 (UTC) |
LESS COMPLEMENT: сanon structura of cross-siments of DNA
TTAACAGGATACCCGATCTAGCCGCAAGCATACTTGACC
TTAACAGCATACTTGACC
TTAACAGGATACCCGATCTAGCCGCAAGCATACTTGACCTAGCCGCAAGCATACTTGACC
TTAACAGGATACCCGATCTAGCCGCAAGGATACTTGACCTAGCCGCAAGCATACTTGACC
and TTAACAGGATACCCGATCTAGCCGCAAGCATACCCGATCTAGCCGCAAGCATACTTGACC
--WITH THISE is quazi COMPLEMENT---
AATTGTCCTATGGGCTAGATCGGCGTTCCTATGGGCTAGATCGGCGTTCGTATGAACTGG
(of Book Singer&Berg Genes and Genomes) total line of the programm searh =20.THE END for thise Quston, ALL comments dont not living!!тишина!
I have tried multiple times to insert a reference correctly at the end of the section on viruses. My reference works perfectly in my sandbox. I have tried using Wikipedia template filling to make sure I did it correctly, but I get the same error each time, Cite error: A [1] (see the help page). Chaya5260 ( talk) 23:39, 8 December 2013 (UTC)
This is a big topic now in ovarian cancer, and as a target of PARP inhibitor drugs. - Rod57 ( talk) 13:10, 30 December 2016 (UTC)
One big issue is if the fragmentation places exhibit some bias (not necessarily absolute but regional), and that opens the path to more questions (if epigenetic changes have an impact on the patterns of recombinant fragmentation).
It doesn't have to happen all the time and at exact places; even small biases play a huge role in millions of years of evolution.
We need more data. — Preceding unsigned comment added by 2A02:587:4104:99BE:B1CD:5E5B:5D0B:33E4 ( talk) 01:37, 22 October 2020 (UTC)
Ref 102 (Viral transmission and evolution dynamics of SARS-CoV-2 in shipboard quarantine) was the correct reference for what was being claimed, with correct name and authorship, but all links went to the subsequent paper from the same journal (Specifically a paper about use of an alcohol screening tool in Russia)
While it was an easy fix, other uses of the same source on different pages, probably should be checked, to see if this is a systemic issue due to the journal readdressing or incorrectly addressing their DOIs initially, or if this is a one time issue. — Preceding unsigned comment added by PewterPenguin ( talk • contribs) 04:41, 27 December 2021 (UTC)
Update:
/info/en/?search=Coronavirus_3%E2%80%B2_stem-loop_II-like_motif_(s2m) Fixed
/info/en/?search=COVID-19_pandemic_on_Diamond_Princess Fixed
/info/en/?search=Diamond_Princess_(ship) Fixed
https://zh.wikipedia.org/wiki/%E9%91%BD%E7%9F%B3%E5%85%AC%E4%B8%BB%E8%99%9F Fixed
All found to have the exact same issue, suggesting systemic issue. WHO Bulletins should probably be watched in the future for changes in links. — Preceding
unsigned comment added by
PewterPenguin (
talk •
contribs)
04:51, 27 December 2021 (UTC)
![]() | Homologous recombination has been listed as one of the Natural sciences good articles under the good article criteria. If you can improve it further, please do so. If it no longer meets these criteria, you can reassess it. | ||||||||||||||||||||||||
|
![]() | This ![]() It is of interest to the following WikiProjects: | ||||||||||||||||
|
![]() | This article links to one or more target anchors that no longer exist.
Please help fix the broken anchors. You can remove this template after fixing the problems. |
Reporting errors |
The introduction does not actually say what HR is. ie. no summary explanation. —Preceding unsigned comment added by 99.234.154.88 ( talk) 19:33, 20 April 2009 (UTC)
I do not know how to add a reference, but would add "Molecular Biology of the Gene, Fifth Edition" by James D. Watson, et al. I started to add it, but it seemed like a mess, so I left it out.
I would add this article also: http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=18022364
It discusses how RecD appears only to be inactivated, not lost from the complex. It has some important information for the RecBCD articles, as well. —Preceding unsigned comment added by RegiG ( talk • contribs) 02:01, 1 July 2008 (UTC)
Hello, I have a few suggestions to help improve this article. First, though, big thanks to Emw2012 for all his recent work on this article. I've been watching these edits and the improvement is really remarkable! Here are my suggestions:
I will help with some of this if I get a chance. Amazinglarry ( talk) 02:29, 24 August 2009 (UTC)
"The World of the Cell", introductory book on Cell biology, ISBN 978-0-321-55418-5, Pearson/BenjaminCummings, mentions on page 627 five different situations in which hom. rec. occurs: 1) Two different phages infect the same bacterium 2) Uptake of raw DNA in bacteria (transformation) 3) Systematic transfer of genetic material (plasmids) between bacteria (conjugation) 4) Prophase I 5) Transfer of bacterial genes between bacteria by incorporation in virus (phage) (transduction). The present article mentions meiosis and mitosis. This seems rather incomplete. -- Ettrig ( talk) 07:19, 7 September 2009 (UTC)
The article currently says "Studies in several model bacteria ...". Is "model" valuable here? I think the normal use of "model" in contexts like these is used to signal that one really is interested in studying a mechanism in the human body, but studying the corresponding mechanism in another organism instead, in the hope that the mechanism in the other organism is sufficiently similar to the human one. This article is not specifically about human HR. -- Ettrig ( talk) 16:13, 10 September 2009 (UTC)
I find that model is used extensively in the article. I think this is because medical research is such a large part of melecular biology research. Possibly the meaning of this expression has changed in the modern context, from used to provide "insight into the workings of other organisms", as Model organism says, to used to provide insight into a particular mechanism, subsystem etc. But for the time being we should stick to the Wikipedia description of the concept. -- Ettrig ( talk) 16:23, 10 September 2009 (UTC)
I think that the section needs to be significantly streamlined, it has a lot of unnecessary information, and it doesn't have any sources for half the things it says. Gobbits ( talk) 07:02, 18 May 2015 (UTC)
For starters, this is a nice article! In the Protein Engineering section, we might consider adding links to DNA shuffling, RACHITT and other similar articles. However, those two articles I mentioned are in need of attention. Pdcook ( talk) 17:03, 18 September 2009 (UTC)
the intro says These new combinations of DNA produce genetic variation. This is grammatically wrong. The process of recombination produces genetic variation. The combinations themselves ARE the genetic variation. The article is so well formulated in general, that I dare not make the corrections myself. In my opinion it is overdue for the GA stamp. -- Ettrig ( talk) 16:00, 21 September 2009 (UTC)
Here are some comments on the article's prose:
Resolved comments
|
---|
|
I will add comments here as I go through the article. As you address issues, please respond beneath the individual concerns above so that I know which are done and which require further discussion. Thanks! --
Cryptic C62 ·
Talk
02:26, 24 June 2010 (UTC)
Review discontinued due to inactivity. If anyone is interested in continuing, feel free to leave a message on my talk page. -- Cryptic C62 · Talk 15:00, 23 August 2010 (UTC)
The lead generally does a very good job. I can't comment on whether it is comprehensive but it is fairly accessible to a lay reader. However, lead terms that may not be understood are: homologous, eukaryotes, protists, eukaryotic, conserved. If you can make those accessible, you stand a chance of keeping the reader beyond the lead!
History:
Once the reader gets past the lead, the first sentence he gets in the history is "Following the discoveries made by Gregor Mendel, it was shown that genes are often linked and do not segregate randomly." This is a bit off putting because it assumes the reader knows what "discoveries" Mendel made. The average reader will connect Mendel with genetics but this is a very advanced genetic topic so will wonder if there's some specific discovery they should know about. I think you need to explain "linked" and "segregate". The latter could also be linked to the appropriate bit in Mendelian inheritance perhaps.
The sentence "Thomas Hunt Morgan introduced the term "crossing over"" doesn't explain what he introduced the term for. It gives an explanation later in the sentence but says this was "shown later" which begs the question why he introduced the term if he didn't know what it meant.
This is such a complex subject that you might need to re-explain jargon that is already explained in the lead. So it probably does no harm to explain meiosis and you haven't yet explained mitosis.
Hans Winkler's "gene conversion" term is not defined. I'm beginning to wonder if the History can only be understood once you've read the article. The "Holliday junctions", "DSBR pathway" and "SDSA pathways" aspects won't really mean anything to the reader at this stage, so they can't really grasp why these discoveries are relevant.
I think the gene targeting sentence "In recognition...2007 Nobel Prize" belongs in this section, not the gene targeting section. I wonder also if some aspects of the cancer therapy is notable enough to appear in the history.
In eukaroytes:
You need to define "eukaroytes". My comments on explaining mitosis/meiosis may apply here if the History section is moved. Define "somatic cells".
The sentence "Chromosomal crossover begins when the Spo11 protein makes a..." is written with the assumption that the reader knows the Spo11 protien and is best friends with its brother. I'm guessing at this stage that I don't need to know much about Spo11 other than what it does here. You can help me feel less ignorant my saying "begins when a protein called Spo11 makes a...". I'm guessing that "programmed" means "deliberate"?
"1,000-2,000 base pair regions of chromosomes" I know what "base pairs" are (well, vaguely) but the general reader wont. They might not appreciate that this appears to be a description of the size of the regions. Should it be "in chromosomes"?
"by the phase of cell cycle" Ok I'm beginning to get lost. Can you give me a brief introduction to the "cell cycle" and the phases. The diagram on the right needs the key from Cell cycle otherwise it isn't telling me anything.
"Cyclin-dependent kinases (CDKs), which modify" I don't know what kinases are never mind Cyclin-dependent ones. Looking up WP, I see they are enzymes. Could we say something like "Homologous recombination in eukaryotes is regulated by cyclin-dependent kinases (CDKs), enzymes that modify the activity of other proteins by adding phosphate groups to them (known as phosphorylation)."
I don't know what "endonuclease activity" is. Or what the MRX complex is.
"a homolog of the bacterial RecQ helicase discussed above" The RecQ helicase is discussed below. So I can't follow this and I don't know what a helicase is.
Colin° Talk 20:37, 25 June 2010 (UTC)
This article has a dead link (ref 2) [1] MacDaid ( talk) 18:28, 26 June 2010 (UTC)
![]() |
An image used in this article,
File:RecBCD recomb model.tif, has been nominated for speedy deletion at
Wikimedia Commons for the following reason: Copyright violations
Don't panic; deletions can take a little longer at Commons than they do on Wikipedia. This gives you an opportunity to contest the deletion (although please review Commons guidelines before doing so). The best way to contest this form of deletion is by posting on the image talk page.
To take part in any discussion, or to review a more detailed deletion rationale please visit the relevant image page (File:RecBCD recomb model.tif) This is Bot placed notification, another user has nominated/tagged the image -- CommonsNotificationBot ( talk) 11:49, 27 March 2012 (UTC) |
LESS COMPLEMENT: сanon structura of cross-siments of DNA
TTAACAGGATACCCGATCTAGCCGCAAGCATACTTGACC
TTAACAGCATACTTGACC
TTAACAGGATACCCGATCTAGCCGCAAGCATACTTGACCTAGCCGCAAGCATACTTGACC
TTAACAGGATACCCGATCTAGCCGCAAGGATACTTGACCTAGCCGCAAGCATACTTGACC
and TTAACAGGATACCCGATCTAGCCGCAAGCATACCCGATCTAGCCGCAAGCATACTTGACC
--WITH THISE is quazi COMPLEMENT---
AATTGTCCTATGGGCTAGATCGGCGTTCCTATGGGCTAGATCGGCGTTCGTATGAACTGG
(of Book Singer&Berg Genes and Genomes) total line of the programm searh =20.THE END for thise Quston, ALL comments dont not living!!тишина!
I have tried multiple times to insert a reference correctly at the end of the section on viruses. My reference works perfectly in my sandbox. I have tried using Wikipedia template filling to make sure I did it correctly, but I get the same error each time, Cite error: A [1] (see the help page). Chaya5260 ( talk) 23:39, 8 December 2013 (UTC)
This is a big topic now in ovarian cancer, and as a target of PARP inhibitor drugs. - Rod57 ( talk) 13:10, 30 December 2016 (UTC)
One big issue is if the fragmentation places exhibit some bias (not necessarily absolute but regional), and that opens the path to more questions (if epigenetic changes have an impact on the patterns of recombinant fragmentation).
It doesn't have to happen all the time and at exact places; even small biases play a huge role in millions of years of evolution.
We need more data. — Preceding unsigned comment added by 2A02:587:4104:99BE:B1CD:5E5B:5D0B:33E4 ( talk) 01:37, 22 October 2020 (UTC)
Ref 102 (Viral transmission and evolution dynamics of SARS-CoV-2 in shipboard quarantine) was the correct reference for what was being claimed, with correct name and authorship, but all links went to the subsequent paper from the same journal (Specifically a paper about use of an alcohol screening tool in Russia)
While it was an easy fix, other uses of the same source on different pages, probably should be checked, to see if this is a systemic issue due to the journal readdressing or incorrectly addressing their DOIs initially, or if this is a one time issue. — Preceding unsigned comment added by PewterPenguin ( talk • contribs) 04:41, 27 December 2021 (UTC)
Update:
/info/en/?search=Coronavirus_3%E2%80%B2_stem-loop_II-like_motif_(s2m) Fixed
/info/en/?search=COVID-19_pandemic_on_Diamond_Princess Fixed
/info/en/?search=Diamond_Princess_(ship) Fixed
https://zh.wikipedia.org/wiki/%E9%91%BD%E7%9F%B3%E5%85%AC%E4%B8%BB%E8%99%9F Fixed
All found to have the exact same issue, suggesting systemic issue. WHO Bulletins should probably be watched in the future for changes in links. — Preceding
unsigned comment added by
PewterPenguin (
talk •
contribs)
04:51, 27 December 2021 (UTC)