Science desk | ||
---|---|---|
< June 18 | << May | June | Jul >> | June 20 > |
Welcome to the Wikipedia Science Reference Desk Archives |
---|
The page you are currently viewing is an archive page. While you can leave answers for any questions shown below, please ask new questions on one of the current reference desk pages. |
Maybe I'm confused, but I've long had the notion that when the moon is full, as it is today, it rises more or less as the sun sets, and it sets more or less as the sun rises. But now that we are near the summer solstice and the days are extra long (up here near 49 degrees north), it occurred to me this would mean the full moon would be up for fewer hours in the summer and more in the winter. That didn't seem right -- shouldn't the full moon be up for about 12 hours regardless? Or if the Earth's tilt matters, wouldn't it mean the moon, like the sun, was up for longer in the summer? But, in checking the sun and moon rise and set times for today and tonight, it appears that today's full moon does rise more or less as the sun sets, and sets more or less as the sun rises (give or take about 30 minutes). This means that today, where I live, the sun is up for about 16 hours and full moon for only slightly more about 6.5 hours. Somewhere my common sense is confused. Where'd I go wrong? Pfly ([[User talk:Pfly|talk]]) 03:37, 19 June 2008 (UTC)
Bold text —Preceding unsigned comment added by 124.253.200.194 ( talk) 04:21, 19 June 2008 (UTC)
How does it happen that dogs wag their tails, while their ancestors the wolves do not? What might be behind this selective advantage? -- Halcatalyst ( talk) 14:28, 19 June 2008 (UTC)
I always thought it was to express emotion. A dog wagging tail is usually friendly or excited, probably running after a ball or something, but an aggressive dog might hold its tail high, while a submissive or scared dog might hold its tail low. This is also true for cats, as a happy cat will hold it's tail high in the air, while a submissive cat will lower it. Also in cats a wagging tail is a sign of conflict, like when it can't decide if it wants to go in or out of the house, or if it twitches it from side to side at the end it means it angry. Could it also be for balance? When a dog is running and turns quickly, the front part of its body goes in the direction it wants to go, but it's back continues in the original direction. So the tail might act as a counterweight. Jessica - N10248 ( talk) 18:21, 20 June 2008 (UTC)
I heard from the Scientific American magazine that dogs wag their tails when they are nervous.-- Apollonius 1236 ( talk) 18:29, 20 June 2008 (UTC)
I have read that using excess catalyst (alkali) in the transesterification process will cause the bonds of methyl esters to break, thus, leaving higher FFA's and free glycerin. Are you aware of any studies, research, white papers, etc. regarding this matter.14:41, 19 June 2008 (UTC) Knowwhat4 ( talk)
The reaction is
(soybeancarboxylic-acid)3glyceride + 3 methanol >>> 3 soybeancarboxylic-acid methyl ester + gylcerin
The reaction you are thinking of is (soybeancarboxylic-acid)3glyceride + 3 water >>> 3 soybeancarboxylic-acid (FFA) + gylcerin
trans-esterification means swapping the R-OH groups (alcohols) see - Transesterification
To obtain FFA (free fatty acid) you need to do hydrolysis
Adding more catalyst may speed up the reaction.. 87.102.86.73 ( talk) 17:04, 19 June 2008 (UTC)
What are the diffrence between the two? —Preceding unsigned comment added by 192.115.235.2 ( talk) 17:00, 19 June 2008 (UTC)
Thanks, The question is if it's the same group? I don't think other insects use the same mechanism since if they do they would be added to the same group. So does it mean the insect group and the mechanism are the same? —Preceding unsigned comment added by 192.115.235.2 ( talk) 18:03, 19 June 2008 (UTC)
From this online gene promoter prediction tool, I get the following possible promoter sequences for GREM1 gene sequence (1000 bp before transcription start site and 1000 bp after). The bold letter is what it claims might be the transcription start site. Is it not possible that they are both promoters with only one (the later) containing the transcription start site?
Promoter predictions for 1 eukaryotic sequence with score cutoff 0.80 (transcription start shown in larger font):
Promoter predictions for seq0 :
Start End Score Promoter Sequence 412 462 0.83 AGCCCGCCAGGTTAACGGGGGCGCCGGGGTCAGCGCCCTCGAAGTTGGGG 961 1011 0.99 TGCCGCCGGCATTTAAACGGGAGACGGCGCGATGCCTGGCACTCGGTGCG
-- 145.29.22.90 ( talk) 17:10, 19 June 2008 (UTC)
There are services that reproduce diplomas and certificates as metal plaques that can be hung on walls. Embossed seals in the original documents are somehow reproduced like stamped marks. Are the reproduced embossed seals manually recreated or are they mechanically converted to printed marks? If the latter, how is it done? -- 71.162.249.253 ( talk) 17:58, 19 June 2008 (UTC)
What is the liklihood that dinosaurs (and/or other such critters) would have evolved to the point of sentience if they had not gone extinct? Would there be a parallel evolution with mammals or is more likey that one species would have out-competed the other? If we remove the mammal factor, would they have developed sentience? —Preceding unsigned comment added by 69.77.185.91 ( talk) 18:36, 19 June 2008 (UTC)
Some scientists speculate that the most intelligent dinosaurs (such as velociraptor and troodon) would have evolved into a bipedal "human like" dinosaur known as the dinosauroid. An artist and scientist Dale Russell has actually produced a sculpture of the hypothetical dinosouroid you can learn more about the dinosauroid and see the dinosauroid sculpture at this entry in the internet encyclopedia of science more information about dinosauroid.-- Apollonius 1236 ( talk) 18:45, 20 June 2008 (UTC)
(I'm guessing that significant extraction of fossil fuels would be detectable today, since most of those are Mesozoic or earlier; I doubt anything would be left of, say, a Mississippian-level civilization except the bones of its builders, and considering how few fossil species we've found... Not that I think it did happen, I hasten to add. For that matter, I don't think the late Mesozoic ecology, with an unusually large portion of the energy locked up in the huge animals, would be very conducive to a smart species evolving reasoning capacity or a reasoning species building a civilization. Intelligence probably wasn't adaptive except at the troodontid's niche; otherwise it probably would have evolved elsewhere. On modern Earth, elephants, crows/ravens, the African grey parrot, dolphins, and primates have independently evolved high levels of intelligence; if it would have helped a ceratopsian or sauropod's survival to be smart, it would probably have become so.) Vultur ( talk) 04:59, 23 June 2008 (UTC)
Listening to the radio the other day, I heard a story about trying to control the cormorant population around Lake Champlain. It seems that biologists are coating the eggs with vegetable oil so that they won't hatch. I'm not really sure how that works but whatever. What occurred to me first was, why don't they just take the eggs away or something easier than coating them with oil? Dismas| (talk) 18:40, 19 June 2008 (UTC)
I have installed one of those wind-turbine roof vents (aka "whirly-bird"). Fans used in "whole house fans" would obviously move much more air but I am curious as to how one would go about measuring the flow of air as it leaves one's attic. OK. Let's be honest: I am really wondering if there is enough airflow via the whirlybird vent to run venting from the whirlybird through the ceiling to move the hotter indoor air (I am thinking of a "passive" approach to the whole house fan idea). —Preceding unsigned comment added by 69.77.185.91 ( talk) 18:44, 19 June 2008 (UTC)
What if somebody kicked me in the testicles and how would it affect my digestive system? Ericthebrainiac ( talk) 19:23, 19 June 2008 (UTC)
Being kicked in the testicles does not affect your digestive system. As for the nauseous feeling you may feel, that's one of the body's many ways of dealing with pain. It's very common to feel sick during extreme pain, such as when kicked in the testicles. Regards, CycloneNimrod talk? contribs? 20:24, 19 June 2008 (UTC)
Not true. The nerve endings in the testicles are connected to your innards. I don't remember what organ exactly. Anyway, it can have a negative effect - feeling pain somewhere in your belly. I felt A LOT of pain somewhere in my belly when I got hit in the testicles. My doctor recomended strengthening abdominal muscles and regularizing eating habits to me. Ask your doctor what he thinks you should do. I still get a weird feeling in the belly sometimes.
I wasn't clear enough. Not only did I experience pain in the belly, but eating could trigger the pain as could going to the restroom. There were also irregularities/difficulties with defecation. The conclusion here is that if these symptoms were experienced by someone kicked in the testicles, they are probably not a product of the imagination, but very real. Hope this is helpful.
I realize that evolution isn't a process that will necessarily produce 'better' or more intelligent organisms over time, but is it true that evolution always tends to produce increasingly complex organisms over time? Are there counter-examples? ike9898 ( talk) 21:11, 19 June 2008 (UTC)
(Remove indent) 98 made a theoretical point which I still think is valid - and I know that this would be impossible to test empirically because there are many many other factors which select each way. Assume the following:
None of these are unreasonable IMHO. So there's a direct link between "intelligent genes" and reproduction.
I don't think anyone is suggesting that certain racial or social groups inherently have more "intelligent genes" simply because there are many other factors which select for and against intelligence/education/wealth/etc - this is just one of those factors and its effect would be impossible to gauge in practice. But none of this invalidates the theoretical point. Zain Ebrahim ( talk) 20:54, 20 June 2008 (UTC)
There is a recent article about an example of the evolution of complexity being observed here: http://www.newscientist.com/channel/life/dn14094-bacteria-make-major-evolutionary-shift-in-the-lab.html There is also a link to 24 myths about evolution, one of which is increasing complexity. 80.0.110.56 ( talk) 14:55, 22 June 2008 (UTC)
For example, any bacteriums? Or, does the nature need only developed creatures? For example, the animals? Must be all bacteriums in the length of time any developed creatures? Have the bacteriums in nature for them any works to do? Can any developed creatures work the same job? Are the bacteriums an evidence of evolutions, because these are simple creatures? Are their job simple for nature? For example. Who can clean the nature (waters etc), if there are not any bacteriums? Have a boing jet only complex components, have not it any simple screws? Are any screws for a boing jet trivial?-- 78.177.173.0 ( talk) 01:24, 20 June 2008 (UTC)
Why say the evolutionists that the microorganisms are any primitiv creatures, if these have a place in nature, in an ecosystem? For example: We have a spoon, a cutlery that these are simple instruments. We need these to eat, not a computer. Must be all things too complex, so that man says these are perfect? Are the microorganisms perfect or primitiv?-- 78.177.173.0 ( talk) 14:19, 21 June 2008 (UTC)
Then, how can the simple bacteria know its job in the too much complex ecosystem, if a bacteria have any simple (brain or intelligence center, or etc.)? How coordinate the nature all these, if these do not know, how all whole ecosystem must work? How can any simple microorganisms works harmonic with nature without knowledge of physical laws and other all knowledge, that it needs for an ecosystem. For example, the humans with a developed brain, do not know good, how the whole ecosystem works. And therefore the mankind annihilate the earth. But any simple organisms support it, live harmonic with it. How can any bacteria etc. take into consideration the all knowledge, so that it works harmonic with nature?-- 78.177.173.0 ( talk) 18:30, 23 June 2008 (UTC)
I often see on forums people saying that it is cheaper to heat a house all day rather than heat it from cold just before you return from work. Of course, this is incorrect and the later option is the correct one.
An example of typical resoning behind the heat-all-day myth is this excerpt: ""Run it constantly....Think about it, it take much more energy to heat a kettle of cold watter, and alot less if its already warm warm, topping it up....Same goes for heating, heating a cold house takes hours, maintaining it at a constat level takes a lot less energy. " From http://www.boilerjuice.com/blog/11/Your-top-tips-for-saving-heating-oil.html
What is the best and most succinct way to refute this mistaken notion? I mean verbally rather than inviting the person to observe an experiment etc, and bearing in mind that the person is unlikely to understand technicalities like the Laws Of Thermodynamics. Thanks. 80.0.101.122 ( talk) 23:36, 19 June 2008 (UTC)
Would anyone like to try writing a brief refutation of the myth, that could be used in forums etc please? 80.0.101.122 ( talk) 23:54, 19 June 2008 (UTC)
All I can say is: "THEY ARE NUTS!"
Wind chill factor has very little to do with your house. Strong wind would surely cold down your house much faster, but wind chill factor is the temperature perceived by your skin which is subjected to water vaporization and many other living thing-only factors. How easily they are fooled.
I cannot work out a nice and easy way to explain the obvious. Maybe they should experiment with it and see their own heating bills. Many brain-dead and uneducated people in the U.S. leave their air conditioners on all the time. Maybe they should also leave their car engines running 24/7/365 because IT SAVES ENERGY NOT TO TURN THEM OFF. -- Toytoy ( talk) 01:17, 20 June 2008 (UTC)
"
Russoc4, you need to learn something about equilibrium before trying to solve this problem. It takes more energy to heat up a cold thing, right? But to keep the warm thing warm, you spend energy to warm it EVERY SINGLE MINUTE. Do I need to show you how confused you are?
You have a 1000 gal tank made of some lousy thin and porous material. You use it to store water. Inside the tank, the water level is 10 ft, outside it is 0 ft. Water seeps out your tank from everywhere on its surface. The higher the water level, the quicker it leaks.
Now you use a pump to keep the water level at 10 ft (THE FIRST 10 FT). At this level, you lose 10 gal per minute. You need to pump in 10 gal/min to keep the water lever constant.
To make the calculation easier, let's assume water loss is directly proportional to the water level; that means 3 gal/min at 3 ft. (This assumption actually makes water loss at 3 ft too high.)
Now you turn off the pump and let the water level gradually fall to 0 ft. Your tank is empty now. The porous material is also dried up (assume the material does not absorb and hold water).
Let's say your pump can do 20 gal/min. No more and no less. You can either turn it on or turn it off. You cannot let it run at 50% speed. THIS IS SIMILAR TO MOST HOME HEATERS. They are either on or off. If hey are adjustable, the range generally falls within a range of maximum efficiency.
It takes time for the pump to fill up your 10 ft tall tank (THE SECOND 10 FT).
Since the average loss of water per minute between the first 10 ft (before turn-off) and the second 10 ft (after restart) shall be lower than 10 gal/min (water level is lower), EACH MINUTE YOUR TANK IS BELOW 10 FT, IT LOSES LESS THAN 10 GAL/MIN.
Let's say you have two tanks side by side, one (always on) is losing 10 gal/min, and the other (turned-off for a period of time) loses less than 10 gal/min during its low water level time (draining time + empty time + fill up time), WHICH ONE IS LESS COSTLY? WHICH ONE USES LESS ENERGY?
You really need to brush up your basic idea about physics. I am harsh. Yet, I am also telling you the truth. You idea is fuzzy and unorganized. -- Toytoy ( talk) 05:04, 20 June 2008 (UTC)
Thank you for replies. I like the example of only heating the house one day a year, although the counter-arguement will be that there is some shorter time-period where it makes sense to leave the heating on. An analogy that has occurred to me is that of a leaky bath with a running tap. Water is leaking out of this bath (heat loss) while at the same time water is slowly running into it from a tap (you might use a different word in American-english) just enough to keep it full. You want the bath to be full when you get home from work - will you save water by letting the tap run all the time, or by turning the tap off in the morning and putting the tap full on to fill the bath in the evening? Thanks 80.0.108.8 ( talk) 12:16, 21 June 2008 (UTC)
If humans were all suddenly wiped out, what would be the last recognisable human artefact to survive millions or billions of years into the future, rather than becoming dust? Manhole covers? 80.0.101.122 ( talk) 23:50, 19 June 2008 (UTC)
According to the book The World Without Us and the Scientific American article about it, broadcasts and radio signals produced by humans may "survive" and travel through space for trillions of years (that is if the universe survives for trillions of years). -- Apollonius 1236 ( talk) 02:48, 21 June 2008 (UTC)
Science desk | ||
---|---|---|
< June 18 | << May | June | Jul >> | June 20 > |
Welcome to the Wikipedia Science Reference Desk Archives |
---|
The page you are currently viewing is an archive page. While you can leave answers for any questions shown below, please ask new questions on one of the current reference desk pages. |
Maybe I'm confused, but I've long had the notion that when the moon is full, as it is today, it rises more or less as the sun sets, and it sets more or less as the sun rises. But now that we are near the summer solstice and the days are extra long (up here near 49 degrees north), it occurred to me this would mean the full moon would be up for fewer hours in the summer and more in the winter. That didn't seem right -- shouldn't the full moon be up for about 12 hours regardless? Or if the Earth's tilt matters, wouldn't it mean the moon, like the sun, was up for longer in the summer? But, in checking the sun and moon rise and set times for today and tonight, it appears that today's full moon does rise more or less as the sun sets, and sets more or less as the sun rises (give or take about 30 minutes). This means that today, where I live, the sun is up for about 16 hours and full moon for only slightly more about 6.5 hours. Somewhere my common sense is confused. Where'd I go wrong? Pfly ([[User talk:Pfly|talk]]) 03:37, 19 June 2008 (UTC)
Bold text —Preceding unsigned comment added by 124.253.200.194 ( talk) 04:21, 19 June 2008 (UTC)
How does it happen that dogs wag their tails, while their ancestors the wolves do not? What might be behind this selective advantage? -- Halcatalyst ( talk) 14:28, 19 June 2008 (UTC)
I always thought it was to express emotion. A dog wagging tail is usually friendly or excited, probably running after a ball or something, but an aggressive dog might hold its tail high, while a submissive or scared dog might hold its tail low. This is also true for cats, as a happy cat will hold it's tail high in the air, while a submissive cat will lower it. Also in cats a wagging tail is a sign of conflict, like when it can't decide if it wants to go in or out of the house, or if it twitches it from side to side at the end it means it angry. Could it also be for balance? When a dog is running and turns quickly, the front part of its body goes in the direction it wants to go, but it's back continues in the original direction. So the tail might act as a counterweight. Jessica - N10248 ( talk) 18:21, 20 June 2008 (UTC)
I heard from the Scientific American magazine that dogs wag their tails when they are nervous.-- Apollonius 1236 ( talk) 18:29, 20 June 2008 (UTC)
I have read that using excess catalyst (alkali) in the transesterification process will cause the bonds of methyl esters to break, thus, leaving higher FFA's and free glycerin. Are you aware of any studies, research, white papers, etc. regarding this matter.14:41, 19 June 2008 (UTC) Knowwhat4 ( talk)
The reaction is
(soybeancarboxylic-acid)3glyceride + 3 methanol >>> 3 soybeancarboxylic-acid methyl ester + gylcerin
The reaction you are thinking of is (soybeancarboxylic-acid)3glyceride + 3 water >>> 3 soybeancarboxylic-acid (FFA) + gylcerin
trans-esterification means swapping the R-OH groups (alcohols) see - Transesterification
To obtain FFA (free fatty acid) you need to do hydrolysis
Adding more catalyst may speed up the reaction.. 87.102.86.73 ( talk) 17:04, 19 June 2008 (UTC)
What are the diffrence between the two? —Preceding unsigned comment added by 192.115.235.2 ( talk) 17:00, 19 June 2008 (UTC)
Thanks, The question is if it's the same group? I don't think other insects use the same mechanism since if they do they would be added to the same group. So does it mean the insect group and the mechanism are the same? —Preceding unsigned comment added by 192.115.235.2 ( talk) 18:03, 19 June 2008 (UTC)
From this online gene promoter prediction tool, I get the following possible promoter sequences for GREM1 gene sequence (1000 bp before transcription start site and 1000 bp after). The bold letter is what it claims might be the transcription start site. Is it not possible that they are both promoters with only one (the later) containing the transcription start site?
Promoter predictions for 1 eukaryotic sequence with score cutoff 0.80 (transcription start shown in larger font):
Promoter predictions for seq0 :
Start End Score Promoter Sequence 412 462 0.83 AGCCCGCCAGGTTAACGGGGGCGCCGGGGTCAGCGCCCTCGAAGTTGGGG 961 1011 0.99 TGCCGCCGGCATTTAAACGGGAGACGGCGCGATGCCTGGCACTCGGTGCG
-- 145.29.22.90 ( talk) 17:10, 19 June 2008 (UTC)
There are services that reproduce diplomas and certificates as metal plaques that can be hung on walls. Embossed seals in the original documents are somehow reproduced like stamped marks. Are the reproduced embossed seals manually recreated or are they mechanically converted to printed marks? If the latter, how is it done? -- 71.162.249.253 ( talk) 17:58, 19 June 2008 (UTC)
What is the liklihood that dinosaurs (and/or other such critters) would have evolved to the point of sentience if they had not gone extinct? Would there be a parallel evolution with mammals or is more likey that one species would have out-competed the other? If we remove the mammal factor, would they have developed sentience? —Preceding unsigned comment added by 69.77.185.91 ( talk) 18:36, 19 June 2008 (UTC)
Some scientists speculate that the most intelligent dinosaurs (such as velociraptor and troodon) would have evolved into a bipedal "human like" dinosaur known as the dinosauroid. An artist and scientist Dale Russell has actually produced a sculpture of the hypothetical dinosouroid you can learn more about the dinosauroid and see the dinosauroid sculpture at this entry in the internet encyclopedia of science more information about dinosauroid.-- Apollonius 1236 ( talk) 18:45, 20 June 2008 (UTC)
(I'm guessing that significant extraction of fossil fuels would be detectable today, since most of those are Mesozoic or earlier; I doubt anything would be left of, say, a Mississippian-level civilization except the bones of its builders, and considering how few fossil species we've found... Not that I think it did happen, I hasten to add. For that matter, I don't think the late Mesozoic ecology, with an unusually large portion of the energy locked up in the huge animals, would be very conducive to a smart species evolving reasoning capacity or a reasoning species building a civilization. Intelligence probably wasn't adaptive except at the troodontid's niche; otherwise it probably would have evolved elsewhere. On modern Earth, elephants, crows/ravens, the African grey parrot, dolphins, and primates have independently evolved high levels of intelligence; if it would have helped a ceratopsian or sauropod's survival to be smart, it would probably have become so.) Vultur ( talk) 04:59, 23 June 2008 (UTC)
Listening to the radio the other day, I heard a story about trying to control the cormorant population around Lake Champlain. It seems that biologists are coating the eggs with vegetable oil so that they won't hatch. I'm not really sure how that works but whatever. What occurred to me first was, why don't they just take the eggs away or something easier than coating them with oil? Dismas| (talk) 18:40, 19 June 2008 (UTC)
I have installed one of those wind-turbine roof vents (aka "whirly-bird"). Fans used in "whole house fans" would obviously move much more air but I am curious as to how one would go about measuring the flow of air as it leaves one's attic. OK. Let's be honest: I am really wondering if there is enough airflow via the whirlybird vent to run venting from the whirlybird through the ceiling to move the hotter indoor air (I am thinking of a "passive" approach to the whole house fan idea). —Preceding unsigned comment added by 69.77.185.91 ( talk) 18:44, 19 June 2008 (UTC)
What if somebody kicked me in the testicles and how would it affect my digestive system? Ericthebrainiac ( talk) 19:23, 19 June 2008 (UTC)
Being kicked in the testicles does not affect your digestive system. As for the nauseous feeling you may feel, that's one of the body's many ways of dealing with pain. It's very common to feel sick during extreme pain, such as when kicked in the testicles. Regards, CycloneNimrod talk? contribs? 20:24, 19 June 2008 (UTC)
Not true. The nerve endings in the testicles are connected to your innards. I don't remember what organ exactly. Anyway, it can have a negative effect - feeling pain somewhere in your belly. I felt A LOT of pain somewhere in my belly when I got hit in the testicles. My doctor recomended strengthening abdominal muscles and regularizing eating habits to me. Ask your doctor what he thinks you should do. I still get a weird feeling in the belly sometimes.
I wasn't clear enough. Not only did I experience pain in the belly, but eating could trigger the pain as could going to the restroom. There were also irregularities/difficulties with defecation. The conclusion here is that if these symptoms were experienced by someone kicked in the testicles, they are probably not a product of the imagination, but very real. Hope this is helpful.
I realize that evolution isn't a process that will necessarily produce 'better' or more intelligent organisms over time, but is it true that evolution always tends to produce increasingly complex organisms over time? Are there counter-examples? ike9898 ( talk) 21:11, 19 June 2008 (UTC)
(Remove indent) 98 made a theoretical point which I still think is valid - and I know that this would be impossible to test empirically because there are many many other factors which select each way. Assume the following:
None of these are unreasonable IMHO. So there's a direct link between "intelligent genes" and reproduction.
I don't think anyone is suggesting that certain racial or social groups inherently have more "intelligent genes" simply because there are many other factors which select for and against intelligence/education/wealth/etc - this is just one of those factors and its effect would be impossible to gauge in practice. But none of this invalidates the theoretical point. Zain Ebrahim ( talk) 20:54, 20 June 2008 (UTC)
There is a recent article about an example of the evolution of complexity being observed here: http://www.newscientist.com/channel/life/dn14094-bacteria-make-major-evolutionary-shift-in-the-lab.html There is also a link to 24 myths about evolution, one of which is increasing complexity. 80.0.110.56 ( talk) 14:55, 22 June 2008 (UTC)
For example, any bacteriums? Or, does the nature need only developed creatures? For example, the animals? Must be all bacteriums in the length of time any developed creatures? Have the bacteriums in nature for them any works to do? Can any developed creatures work the same job? Are the bacteriums an evidence of evolutions, because these are simple creatures? Are their job simple for nature? For example. Who can clean the nature (waters etc), if there are not any bacteriums? Have a boing jet only complex components, have not it any simple screws? Are any screws for a boing jet trivial?-- 78.177.173.0 ( talk) 01:24, 20 June 2008 (UTC)
Why say the evolutionists that the microorganisms are any primitiv creatures, if these have a place in nature, in an ecosystem? For example: We have a spoon, a cutlery that these are simple instruments. We need these to eat, not a computer. Must be all things too complex, so that man says these are perfect? Are the microorganisms perfect or primitiv?-- 78.177.173.0 ( talk) 14:19, 21 June 2008 (UTC)
Then, how can the simple bacteria know its job in the too much complex ecosystem, if a bacteria have any simple (brain or intelligence center, or etc.)? How coordinate the nature all these, if these do not know, how all whole ecosystem must work? How can any simple microorganisms works harmonic with nature without knowledge of physical laws and other all knowledge, that it needs for an ecosystem. For example, the humans with a developed brain, do not know good, how the whole ecosystem works. And therefore the mankind annihilate the earth. But any simple organisms support it, live harmonic with it. How can any bacteria etc. take into consideration the all knowledge, so that it works harmonic with nature?-- 78.177.173.0 ( talk) 18:30, 23 June 2008 (UTC)
I often see on forums people saying that it is cheaper to heat a house all day rather than heat it from cold just before you return from work. Of course, this is incorrect and the later option is the correct one.
An example of typical resoning behind the heat-all-day myth is this excerpt: ""Run it constantly....Think about it, it take much more energy to heat a kettle of cold watter, and alot less if its already warm warm, topping it up....Same goes for heating, heating a cold house takes hours, maintaining it at a constat level takes a lot less energy. " From http://www.boilerjuice.com/blog/11/Your-top-tips-for-saving-heating-oil.html
What is the best and most succinct way to refute this mistaken notion? I mean verbally rather than inviting the person to observe an experiment etc, and bearing in mind that the person is unlikely to understand technicalities like the Laws Of Thermodynamics. Thanks. 80.0.101.122 ( talk) 23:36, 19 June 2008 (UTC)
Would anyone like to try writing a brief refutation of the myth, that could be used in forums etc please? 80.0.101.122 ( talk) 23:54, 19 June 2008 (UTC)
All I can say is: "THEY ARE NUTS!"
Wind chill factor has very little to do with your house. Strong wind would surely cold down your house much faster, but wind chill factor is the temperature perceived by your skin which is subjected to water vaporization and many other living thing-only factors. How easily they are fooled.
I cannot work out a nice and easy way to explain the obvious. Maybe they should experiment with it and see their own heating bills. Many brain-dead and uneducated people in the U.S. leave their air conditioners on all the time. Maybe they should also leave their car engines running 24/7/365 because IT SAVES ENERGY NOT TO TURN THEM OFF. -- Toytoy ( talk) 01:17, 20 June 2008 (UTC)
"
Russoc4, you need to learn something about equilibrium before trying to solve this problem. It takes more energy to heat up a cold thing, right? But to keep the warm thing warm, you spend energy to warm it EVERY SINGLE MINUTE. Do I need to show you how confused you are?
You have a 1000 gal tank made of some lousy thin and porous material. You use it to store water. Inside the tank, the water level is 10 ft, outside it is 0 ft. Water seeps out your tank from everywhere on its surface. The higher the water level, the quicker it leaks.
Now you use a pump to keep the water level at 10 ft (THE FIRST 10 FT). At this level, you lose 10 gal per minute. You need to pump in 10 gal/min to keep the water lever constant.
To make the calculation easier, let's assume water loss is directly proportional to the water level; that means 3 gal/min at 3 ft. (This assumption actually makes water loss at 3 ft too high.)
Now you turn off the pump and let the water level gradually fall to 0 ft. Your tank is empty now. The porous material is also dried up (assume the material does not absorb and hold water).
Let's say your pump can do 20 gal/min. No more and no less. You can either turn it on or turn it off. You cannot let it run at 50% speed. THIS IS SIMILAR TO MOST HOME HEATERS. They are either on or off. If hey are adjustable, the range generally falls within a range of maximum efficiency.
It takes time for the pump to fill up your 10 ft tall tank (THE SECOND 10 FT).
Since the average loss of water per minute between the first 10 ft (before turn-off) and the second 10 ft (after restart) shall be lower than 10 gal/min (water level is lower), EACH MINUTE YOUR TANK IS BELOW 10 FT, IT LOSES LESS THAN 10 GAL/MIN.
Let's say you have two tanks side by side, one (always on) is losing 10 gal/min, and the other (turned-off for a period of time) loses less than 10 gal/min during its low water level time (draining time + empty time + fill up time), WHICH ONE IS LESS COSTLY? WHICH ONE USES LESS ENERGY?
You really need to brush up your basic idea about physics. I am harsh. Yet, I am also telling you the truth. You idea is fuzzy and unorganized. -- Toytoy ( talk) 05:04, 20 June 2008 (UTC)
Thank you for replies. I like the example of only heating the house one day a year, although the counter-arguement will be that there is some shorter time-period where it makes sense to leave the heating on. An analogy that has occurred to me is that of a leaky bath with a running tap. Water is leaking out of this bath (heat loss) while at the same time water is slowly running into it from a tap (you might use a different word in American-english) just enough to keep it full. You want the bath to be full when you get home from work - will you save water by letting the tap run all the time, or by turning the tap off in the morning and putting the tap full on to fill the bath in the evening? Thanks 80.0.108.8 ( talk) 12:16, 21 June 2008 (UTC)
If humans were all suddenly wiped out, what would be the last recognisable human artefact to survive millions or billions of years into the future, rather than becoming dust? Manhole covers? 80.0.101.122 ( talk) 23:50, 19 June 2008 (UTC)
According to the book The World Without Us and the Scientific American article about it, broadcasts and radio signals produced by humans may "survive" and travel through space for trillions of years (that is if the universe survives for trillions of years). -- Apollonius 1236 ( talk) 02:48, 21 June 2008 (UTC)