From Wikipedia, the free encyclopedia
If you are an author of one of the following articles, then there is a good chance we don't have your family in Rfam yet. Thanks to the journal
RNA Biology you can gain recognition for helping us share your RNA with the research community. All you need to do is publish an RNA families article. The requirements are 1) an article 2) a
Stockholm formatted alignment with consensus secondary structure annotation and 3) a Wikipedia article.
HIGH PRIORITY:
Translation on demand by a simple RNA-based thermosensor
HIGH PRIORITY:
Widespread Occurrence of Self-Cleaving Ribozymes
Lots of data in the supp mat.
HIGH PRIORIY:
A PhoQ/P-Regulated small RNA Regulates Sensitivity of Escherichia coli to Antimicrobial Peptides -- RNA Biol. invite sent - 23 Oct 2010
HIGH PRIORITY:
Evidence for a major role of antisense RNAs in cyanobacterial gene regulation
Stem-loop structure of Cocksfoot mottle virus RNA is indispensable for programmed -1 ribosomal frameshifting.
HIGH PRIORITY:
A discontinuous hammerhead ribozyme embedded in a mammalian messenger RNA
HIGH PRIORITY: Update the SgrS model:
Homologs of the small RNA SgrS are broadly distributed in enteric bacteria but have diverged in size and sequence The alignment is
here, see figure 3 for the secondary structure.
HIGH PRIORITY:
A noncoding RNA gene on chromosome 10p15.3 may function upstream of hTERT family build but need to write wiki io3
HIGH PRIORITY: The other non-coding HARs. Not HAR1F.
An RNA gene expressed during cortical development evolved rapidly in humans
Forces Shaping the Fastest Evolving Regions in the Human Genome
use the ucsc track
here
HIGH PRIORIY: Messenger RNA targeting to endoplasmic reticulum stress signalling sites
[1]
HIGH PRIORIY: Palmenberg AC, Spiro D, Kuzmickas R, Wang S, Djikeng A, Rathe JA, Fraser-Liggett CM, Liggett SB.
Sequencing and Analyses of All Known Human Rhinovirus Genomes Reveals Structure and Evolution. Science. 2009 Feb 12. -- RNA Biol. invite sent - 23 Oct 2010
HIGH PRIORITY:
RNA elements associated with an RNA dependent RNA polymerase.
HIGH PRIORIY:
RivR and the small RNA RivX: the missing links between the CovR regulatory cascade and the Mga regulon. -- RNA Biol. invite sent - 23 Oct 2010
HIGH PRIORIY: YFR families:
Yfr1
Nakamura et al. Grab alignments and structure from
Voss et al.
See the RT ticket #86616
The Challenge of Regulation in a Minimal Photoautotroph: Non-Coding RNAs in Prochlorococcus
And the Voss et al. article in RNA Biol.
HIGH PRIORIY:
The rpoS mRNA leader recruits Hfq to facilitate annealing with DsrA sRNA Toby J. Soper1 and Sarah A. Woodson wiki written but need to finish building family
HIGH PRIORITY:
RNA-mediated epigenetic programming of a genome-rearrangement pathway
HIGH PRIORITY:
Architecture and secondary structure of an entire HIV-1 RNA genome Check the frameshift element .-- RNA Biol. invite sent - 23 Oct 2010
HIGH PRIORIY:
Hutton, M.; Lendon, C. L.; Rizzu, P.; Baker, M.; Froelich, S.; Houlden, H.; Pickering-Brown, S.; Chakraverty, S.; Isaacs, A.; Grover, A.; Hackett, J.; Adamson, J.; and 39 others : Association of missense and 5-prime-splice-site mutations in tau with the inherited dementia FTDP-17. Nature 393: 702-705, 1998. PubMed ID : 9641683
omim for text...
HIGH PRIORIY:
A Strand-Specific RNA–Seq Analysis of the Transcriptome of the Typhoid Bacillus Salmonella Typhi -- models built -- need checking in -- pg5
PMID 14712717
Role of RNA Structure in Transcription Attenuation in Bacillus subtilis: The trpEDCFBA Operon as a Model System
The Transcriptionally Active Regions in the Genome of Bacillus subtilis
new rfam user email 201206 (pyrG)
this?: Regulation of pyrG expression in Bacillus subtilis: CTP-regulated antitermination and reiterative transcription with pyrG templates in vitro
Medium priority: PMID 18697947
The Bacillus subtilis iron-sparing response is mediated by a Fur-regulated small RNA and three small, basic proteins
Identification of regulatory RNAs in Bacillus subtilis
PMID 000000
Identification of genes for small non-coding RNAs that belong to the regulon of the two-component regulatory system CiaRH in Streptococcus
PMID 20525227
Identification of novel non-coding small RNAs from Streptococcus pneumoniae TIGR4 using high-resolution genome tiling arrays
Identification and Characterization of Non-Coding Small RNAs in Streptococcus pneumoniae Serotype 2 Strain D39.
Whole-Genome Tiling Array Analysis of Mycobacterium leprae RNA Reveals High Expression of Pseudogenes and Noncoding Regions
PMID 20181675
Multiple small RNAs identified in Mycobacterium bovis BCG are also expressed in Mycobacterium tuberculosis and Mycobacterium smegmatis
MEDIUM PRIORITY: UptR RNA:
GenBank: AF272839.1
PMID 11157926
Oversynthesis of a New Escherichia coli Small RNA Suppresses Export Toxicity of DsbA'-PhoA Unfoldable Periplasmic Proteins
Medium priority: PMID 20075074
Translational Regulation of Gene Expression by an Anaerobically Induced Small Non-coding RNA in Escherichia coli
PMID 9620955
Promoter Region of the Escherichia coli O7-Specific Lipopolysaccharide Gene Cluster: Structural and Functional Characterization of an Upstream Untranslated mRNA Sequence
Regulation of clpQ+Y+ (hslV+U+) Gene Expression in Escherichia coli
PMID 1722556 Structure of two retrons of Escherichia coli and their common chromosomal insertion site
PMID 20407422
Two antisense RNAs target the transcriptional regulator CsgD to inhibit curli synthesis
PMID 12892895 msDNA-St85, a multicopy single-stranded DNA isolated from Salmonella enterica serovar Typhimurium LT2 with the genomic analysis of its retron.
PMID 12829299 Retron reverse transcriptase rrtT is ubiquitous in strains of Salmonella enterica serovar Typhimurium.
PMID 20460466
Experimental identification and characterization of 97 novel npcRNA candidates in Salmonella enterica serovar Typhi
Cartography of Methicillin-Resistant S. aureus Transcripts: Detection, Orientation and Temporal Expression during Growth Phase and Stress Conditions
Medium priority: PMID 20511587
Experimental discovery of small RNAs in Staphylococcus aureus reveals a riboregulator of central metabolism.
PMID 20151104
Identification of differentially expressed small non-protein-coding RNAs in Staphylococcus aureus displaying both the normal and the small-colony variant phenotype
A search for small noncoding RNAs in Staphylococcus aureus reveals a conserved sequence motif for regulation.
HIGH PRIORITY: PMID 20164839
The primary transcriptome of the major human pathogen Helicobacter pylori
A small-RNA-mediated negative feedback loop controls quorum-sensing dynamics in Vibrio harveyi Kimberly C. Tu 1 , Christopher M. Waters 1,2 , Sine L. Svenningsen 1 and Bonnie L. Bassler
PMID 20447992
Identification of non-coding RNAs in environmental vibrios.
Jane M. Liu1, Jonathan Livny2, Michael S. Lawrence3, Marc D. Kimball1, Matthew K. Waldor2 and Andrew Camilli1,
Experimental discovery of sRNAs in Vibrio cholerae by direct cloning, 5S/tRNA depletion and parallel sequencing
PMID 20618945
Experimental annotation of the human pathogen Candida albicans coding and noncoding transcribed regions using high-resolution tiling arrays
PMID 21051342
Developmental expression of non-coding RNAs in Chlamydia trachomatis during normal and persistent growth
PMID 19923228
Deep sequencing-based discovery of the Chlamydia trachomatis transcriptome
PMID 21053272
A coding RNA segment that enhances the ribosomal recruitment of chicken ccn1 mRNA
PMID 20460460
A small nucleolar RNA functions in rRNA processing in Caenorhabditis elegans.
Medium priority:
17A, a novel non-coding RNA, regulates GABA B alternative splicing and signaling in response to inflammatory stimuli and in Alzheimer disease -- RNA Biol. invite sent 25/10/10
sequence
PMID 20739539
An RNA pseudoknot is required for the production of yellow fever virus sfRNA by the host nuclease XRN1.
PMID 20601471
CrfA: An sRNA regulator of adaptation to carbon starvation in Caulobacter crescentus.
PMID 20581224
An Alu-like RNA promotes cell differentiation and reduces malignancy of human neuroblastoma cells.
PMID 19004935
Structural and Functional Studies of the Promoter Element for Dengue Virus RNA Replication
PMID 20561661
A Y-shaped RNA structure in the 3′ untranslated region together with the trans-activator and core promoter of Red clover necrotic mosaic virus RNA2 is required for its negative-strand RNA synthesis
PMID 20348540
Genomic SELEX for Hfq-binding RNAs identifies genomic aptamers predominantly in antisense transcripts
Medium priority: PMID 20559624
The small RNA Aar in Acinetobacter baylyi: a putative regulator of amino acid metabolism -- RNA Biol. invite sent 25/10/10
PMID 20532207
An RNA Element at the 5′-End of the Poliovirus Genome Functions as a General Promoter for RNA Synthesis
Medium priority: VirR :
PMID 20572941
Stabilization of Clostridium perfringens collagenase mRNA by VR-RNA-dependent cleavage in 5′ leader sequence -- RNA Biol. invite sent 25/10/10
PMID 16102006
VirR, a response regulator critical for Listeria monocytogenes virulence.
Comparative genomics of VirR regulons in Clostridium perfringens strains
PMID 20150415
RNPomics: Defining the ncRNA transcriptome by cDNA library generation from ribonucleo-protein particles
PMID 20482898
Identification of four novel small non-coding RNAs from Xanthomonas campestris pathovar campestris
PMID 20081206
Plant U13 orthologues and orphan snoRNAs identified by RNomics of RNA from Arabidopsis nucleoli
PMID 20190049
Transcriptome analysis of Pseudomonas syringae identifies new genes, noncoding RNAs, and antisense activity.
RNA Biology -Walter Moss: PMID 20421411
R2 retrotransposons encode a self-cleaving ribozyme for processing from an rRNA co-transcript.
PMID 19934254
An internal ribosomal entry site mediates redox-sensitive translation of Nrf2.
PMID 8809762
Countertranscript-driven attenuation system of the pAM beta 1 repE gene.
PMID 20304999
Abundant 5S rRNA-like Transcripts Encoded by the Mitochondrial Genome in Amoebozoa
PMID 20333302
The Complete Genome Sequence of Haloferax volcanii DS2, a Model Archaeon
CRISPR and a snoRNA not in Rfam.
PMID 18844986
RNomics and Modomics in the halophilic archaea Haloferax volcanii: identification of RNA modification genes.
PMID 20227418
Heterocyst-specific transcription of NsiR1, a non-coding RNA encoded in a tandem array of direct repeats in cyanobacteria.
Medium priority: PMID 20194114
Identification of a structural element of the hepatitis C virus minus strand RNA involved in the initiation of RNA synthesis
PMID 19969542
A new type of IRES within gag coding region recruits three initiation complexes on HIV-2 genomic RNA
PMID 20174632
ZNF9 Activation of IRES-Mediated Translation of the Human ODC mRNA Is Decreased in Myotonic Dystrophy Type 2.
PMID 20176063
A 3' terminal stem-loop structure in Nodamura virus RNA2 forms an essential cis-acting signal for RNA replication.
PMID 20150415
RNPomics: Defining the ncRNA transcriptome by cDNA library generation from ribonucleo-protein particles
PMID 20129941
A novel antisense RNA regulates at transcriptional level the virulence gene icsA of Shigella flexneri.
PMID 20130131
Genomic features and evolutionary constraints in Saffold-like Cardioviruses.
PMID 20113528
Identification of novel non-coding RNAs using profiles of short sequence reads from next generation sequencing data
PMID 20089193
Genome-wide detection of predicted non-coding RNAs in Rhizobium etli expressed during free-living and host-associated growth using a high-resolution tiling array
RNA dependent RNA polymerase of hepatitis C virus binds to its coding region RNA stem-loop structure, 5BSL3.2, and its negative strand
Functional analysis of RNA structures present at the 3' extremity of the murine norovirus genome: The variable polypyrimidine tract plays a role in viral virulence
The utrophin A 5'UTR drives cap-independent translation exclusively in skeletal muscles of transgenic mice and interacts with eEF1A2.
PMID 19884261
A single-base resolution map of an archaeal transcriptome
Preferential translation of Hsp83 in Leishmania requires a thermosensitive polypyrimidine-rich element in the 3' UTR and involves scanning of the 5' UTR.
Large Intergenic Cruciform-Like Supermotifs in the Lactobacillus plantarum Genome
Deep RNA sequencing of L. monocytogenes reveals overlapping and extensive stationary phase and sigma B-dependent transcriptomes, including multiple highly transcribed noncoding RNAs
snaR
Novel rapidly evolving hominid RNAs bind nuclear factor 90 and display tissue-restricted distribution
snaR Genes: Recent Descendants of Alu Involved in the Evolution of Chorionic Gonadotropins
Yeast RNase III Triggers Polyadenylation-Independent Transcription Termination
Secondary structure of the 5' nontranslated regions of hepatitis C virus and pestivirus genomic RNAs.
Regulation of Translational Efficiency by Disparate 5' UTRs of PPARgamma Splice Variants.
RNA elements within the 5' UTR of West Nile virus genome are critical for RNA synthesis and viral replication.
Limited complementarity between U1 snRNA and a retroviral 5' splice site permits its attenuation via RNA secondary structure
A new type of IRES within gag coding region recruits three initiation complexes on HIV-2 genomic RNA
Deep sequencing analysis of the Methanosarcina mazei Gö1 transcriptome in response to nitrogen availability
Non-coding RNA of glutamine synthetase I modulates antibiotic production in Streptomyces coelicolor A3(2)
Splicing:
Role of RNA structure in regulating pre-mRNA splicing
Euprosterna elaeasa virus genome sequence and evolution of the Tetraviridae family: Emergence of bipartite genomes and conservation of the VPg signal with the dsRNA Birnaviridae family.
SECIS elements
Potential SECIS Elements in HIV-1 Strain HXB2
Selenoprotein synthesis in archaea: identification of an mRNA element of Methanococcus jannaschii probably directing selenocysteine insertion
Characterization of Mammalian Selenoproteomes
Heterologous expression of archaeal selenoprotein genes directed by the SECIS element located in the 3' non-translated region
Selenocysteine insertion directed by the 3′-UTR SECIS element in Escherichia coli
Identification of Leishmania selenoproteins and SECIS element
SECIS elements in the coding regions of selenoprotein transcripts are functional in higher eukaryotes
A selenocysteine tRNA and SECIS element in Plasmodium falciparum
The prokaryotic selenoproteome
Evolutionarily different RNA motifs and RNA–protein complexes to achieve selenoprotein synthesis
Giardia snoRNAs (Lesley Collins may write and RNA Biol. article):
Genbank
Identification and evolutionary implication of four novel box H/ACA snoRNAs from Giardia lamblia
snoRNA, a Novel Precursor of microRNA in Giardia lamblia
Identification of 20 snoRNA-like RNAs from the primitive eukaryote, Giardia lamblia
URE2 IRES
Internal initiation drives the synthesis of Ure2 protein lacking the prion domain and affects [URE3 propagation in yeast cells]
A Small Stem Loop Element Directs Internal Initiation of the URE2 Internal Ribosome Entry Site in Saccharomyces cerevisiae
Characterization of the functional role of nucleotides within the URE2 IRES element and the requirements for eIF2A-mediated repression
An RNA Structural Switch Regulates Diploid Genome Packaging by Moloney Murine Leukemia Virus
Stem Loop Sequences Specific to Transposable Element IS605 Are Found Linked to Lipoprotein Genes in Borrelia Plasmids
Photooxidative stress induced and abundant small RNAs in Rhodobacter sphaeroides
Structural homology between Bamboo mosaic virus and its satellite RNAs in the 5' untranslated region
Bioinformatic evidence for a stem-loop structure 5'-adjacent to the IGR-IRES and for an overlapping gene in the bee paralysis dicistroviruses
PCA3
A global view of the nonprotein-coding transcriptome in Plasmodium falciparum
What is our coverage of table 1? -- pretty close to 100% I suspect:
An overview of RNAs with regulatory functions in gram-positive bacteria
Characterization of the functional role of nucleotides within the URE2 IRES element and the requirements for eIF2A-mediated repression
Kinetic mechanism for the binding of eIF4F and tobacco etch virus internal ribosome entry site RNA: effects of eIF4B and poly A binding protein.
Limited complementarity between U1 snRNA and a retroviral 5' splice site permits its attenuation via RNA secondary structure.
Small RNA-dependent expression of secondary metabolism is controlled by Krebs cycle function in Pseudomonas fluorescens
Large telomerase RNA, telomere length heterogeneity and escape from senescence in Candida glabrata
An Intergenic Non-Coding rRNA Correlated with Expression of the rRNA and Frequency of an rRNA Single Nucleotide Polymorphism in Lung Cancer Cells
The XIAP IRES activates 3′ cistron expression by inducing production of monocistronic mRNA in the βgal/CAT bicistronic reporter system
A new internal-ribosome-entry-site motif potentiates XIAP- mediated cytoprotection
IRESdatabase
iresite
Giardiavirus Internal Ribosome Entry Site Has an Apparently Unique Mechanism of Initiating Translation
The stimulatory RNA of the Visna-Maedi retrovirus ribosomal frameshifting signal is an unusual pseudoknot with an interstem element
Apical Loop-Internal Loop RNA Pseudoknots - A NEW TYPE OF STIMULATOR OF-1 TRANSLATIONAL FRAMESHIFTING IN BACTERIA
Rose spring dwarf-associated virus has RNA structural and gene-expression features like those of Barley yellow dwarf virus
frameshift elements: -- Andrew Firth
A conserved predicted pseudoknot in the NS2A-encoding sequence of West Nile and Japanese encephalitis flaviviruses suggests NS1' may derive from ribosomal frameshifting.
NS1' of flaviviruses in the Japanese encephalitis serogroup is a product of ribosomal frameshifting and plays a role in viral neuro-invasiveness
NS1' of Flaviviruses in the Japanese Encephalitis Virus Serogroup Is a Product of Ribosomal Frameshifting and Plays a Role in Viral Neuroinvasiveness
Discovery of frameshifting in Alphavirus 6K resolves a 20-year enigma
Age- and division-of-labour-dependent differential expression of a novel non-coding RNA, Nb-1, in the brain of worker honeybees, Apis mellifera L.
U36C, clan with snR47.
Expression of small RNAs in Rhizobiales and protection of a small RNA and its degradation products by Hfq in Sinorhizobium meliloti
Two Small RNAs Encoded within the First 1.5 Kilobases of the Herpes Simplex Virus Type 1 Latency-Associated Transcript Can Inhibit Productive Infection and Cooperate To Inhibit Apoptosis
Packaging of host mY RNAs by murine leukemia virus may occur early in Y RNA biogenesis -- update the wikipedia entry ...
Mouse hepatitis virus stem-loop 2 adopts an uYNMG(U)a-like tetraloop structure that is highly functionally tolerant of base substitutions
De Novo Computational Prediction of Non-coding RNA Genes in Prokaryotic Genomes
Comparative analysis of the large fragment of the 5′ untranslated region (LF-5′ UTR) of serotype A foot-and-mouth disease virus field isolates from India
Phylogenetic prediction of cis-acting elements: is there a cre-like sequence in Norovirus genome?
Identification of a Conserved RNA Replication Element (cre) within the 3Dpol-Coding Sequence of Hepatoviruses{triangledown}
Three discontinuous loop nucleotides in the 3′ terminal stem-loop are required for Red clover necrotic mosaic virus RNA-2 replication
Specific and pleiotropic patterns of mRNA regulation by ArcZ, a conserved, Hfq-dependent small RNA
Dinoflagellate Spliced Leader RNA Genes Display a Variety of Sequences and Genomic Arrangements
Importance of mRNA Secondary Structural Elements for the Expression of Influenza Virus Genes
In vitro characterization of a miR-122-sensitive double-helical switch element in the 5' region of hepatitis C virus RNA
Structural and functional elements of the promoter encoded by 5'UTR of Venezuelan equine encephalitis virus genome
In vitro selection of RNA aptamers derived from a genomic human library, against the TAR RNA element of HIV-1
A novel Drosophila antisense scaRNA with a predicted guide function Check Genbank: (Tortoriello) AND "Drosophila melanogaster"[porgn:__txid7227]
VS ribozyme
Check the mRNA elements descirbed in:
The role of mRNA structure in translational control in bacteria
RNA secondary structures in the proximal 3′UTR of Indonesian Dengue 1 virus strains
Paul is working on this one: Build some Rho-independent transcription terminators models?
1
2
3 . Ideally use
these . Slurp
these .
Deletion of a conserved noncoding sequence in Plzf intron leads to Plzf down-regulation in limb bud and polydactyly in the rat
Intergenic regions of Borrelia plasmids contain phylogenetically conserved RNA secondary structure motifs
PMID 19397915
Secondary structures for 5' regions of R2 retrotransposon RNAs reveal a novel conserved pseudoknot and regions that evolve under different constraints.
Genomic structure, chromosomal localization and expression profile of a porcine long non-coding RNA isolated from long SAGE libraries
Mapping the Burkholderia cenocepacia niche response via high-throughput sequencing
Small RNAs in Haloarchaea: Identification, differential expression and biological function
Marchais A, Naville M, Bohn C, Bouloc P, Gautheret D.
Single-Pass Classification of all Non-Coding Sequences in a Bacterial Genome Using Phylogenetic Profiles. Genome Res. 2009 Feb 23.
CBL-3: Epstein-Barr virus-induced expression of a novel human vault RNA. J Mol Biol. 2009 Mar 16; Authors: Nandy C, Mrázek J, Stoiber H, Grässer FA, Hüttenhofer A, Polacek N
Guo L, Allen E, and Miller WA Structure and function of a cap-independent translation element that functions in either the 3 or the 5 untranslated region. RNA 2000; 6(12), 1808-20 AND
Khaladkar M, Liu J, Wen D, Wang JT, Tian B.
Mining small RNA structure elements in untranslated regions of human and mouse mRNAs using structure-based alignment. 2008 Apr 25;9:189.Click here to read
Prediction of Sinorhizobium meliloti sRNA genes and experimental detection in strain 2011 Claudio Valverde1 email, Jonathan Livny2 email, Jan-Philip Schlüter3,4 email, Jan Reinkensmeier5 email, Anke Becker3,4 email and Gustavo Parisi
Non-coding RNAs revealed during identification of genes involved in chicken immune responses. Marie-Laure Endale Ahanda1 Contact Information, Thomas Ruby1 Contact Information, Håkan Wittzell, et al.
A phage RNA-binding protein binds to a non-cognatenext term structured RNA and stabilizes its core structure Xie MH, Wu QJ, Jiang YF, Bao PH, Zhang Y. Biochem Biophys Res Commun. 2008 Nov 7.
Novel long non-protein coding RNAs involved in Arabidopsis differentiation and stress responses Besma Ben Amor1, Sonia Wirth1, Francisco Merchan1, Philippe Laporte1, Yves D'aubenton-Carafa2, Judith Hirsch3, Alexis Maizel1, et al.
Julia C. Kenyon, Akela Ghazawi, Winsome K.S. Cheung, et al. The secondary structure of the 5′ end of the FIV genome reveals a long-range interaction between R/U5 and gag sequences, and a large, stable stem–loop.
Characterization of 43 Non-Protein-Coding mRNA Genes in Arabidopsis, Including the MIR162a-Derived Transcripts1. Judith Hirsch2,3, Vincent Lefort2,4, Marion Vankersschaver5, Adnane Boualem6, Antoine Lucas, Claude Thermes, Yves d’Aubenton-Carafa, and Martin Crespi Plant Physiology, April 2006, Vol. 140, pp. 1192–1204.
ATXN8 opposite strand (non-protein coding)
Detection of small RNAs in Pseudomonas aeruginosa by RNomics and structure-based bioinformatic tools Elisabeth Sonnleitner1, Theresa Sorger-Domenigg1, Monika J. Madej2, Sven Findeiss3, Jörg Hackermüller3, Alexander Hüttenhofer2, Peter F. Stadler3, Udo Bläsi1 and Isabella Moll1
Small RNA ArrF Regulates the Expression of sodB and feSII Genes in Azotobacter vinelandii Yean-Sung Jung and Young-Man Kwon
Androgen responsive intronic non-coding RNAs Rodrigo Louro,1 Helder I Nakaya,1 Paulo P Amaral,1 Fernanda Festa,1 Mari C Sogayar,1 Aline M da Silva,1 Sergio Verjovski-Almeida,1 and Eduardo M Reis
Ishii N, Ozaki K, Sato H, Mizuno H, Saito S, Takahashi A, Miyamoto Y, Ikegawa S, Kamatani N, Hori M, Saito S, Nakamura Y, Tanaka T Identification of a novel non-coding RNA, MIAT, that confers risk of myocardial infarction. J Hum Genet. 2006; 51:(12)1087-99
Novel noncoding antisense RNA transcribed from human anti-NOS2A locus is differentially regulated during neuronal differentiation of embryonic stem cells. Korneev SA, Korneeva EI, Lagarkova MA, Kiselev SL, Critchley G, O'Shea M.
Non-coding RNA as a trigger of neuropathologic disorder phenotypes in transgenic Drosophila Elena Savvateeva-Popova1 Contact Information, Andrej Popov2, Abraham Grossman3, Ekaterina Nikitina1, Anna Medvedeva1, Dmitry Molotkov1, Nicholas Kamyshev1, Konstantin Pyatkov4, Olga Zatsepina5, Natalya Schostak5, Elena Zelentsova5, Galina Pavlova6, Dmitry Panteleev6, Peter Riederer7 and Michail Evgen`ev5
Secondary Structure of the rRNA ITS2 Region Reveals Key Evolutionary Patterns in Acroporid Corals Annette W. Coleman and Madeleine J. H. van Oppen
A starvation-induced noncoding RNA modulates expression of Dicer-regulated genes
Deep Sequencing Analysis of Small Noncoding RNA and mRNA Targets of the Global Post-Transcriptional Regulator, Hfq
RNA secondary structure of the feline immunodeficiency virus 5'UTR and Gag coding region
Update RNAI wrt this
reference, add RNAII.
The secondary structure of the HIV-1 transcript modulates viral splicing and infectivity
Dai et al
The evolution of courtship behaviors through the origination of a new gene in Drosophila PNAS, May 27, 2008, vol. 105 no. 21, 7478-7483
Wilhelm et al.
Dynamic repertoire of a eukaryotic transcriptome surveyed at single-nucleotide resolution (2008) Nature.
Chun-Long Chen et al.
Genomewide Analysis of Box C/D and Box H/ACA snoRNAs in Chlamydomonas reinhardtii Reveals an Extensive Organization Into Intronic Gene Clusters (2008) Genetics, Vol. 179, 21-30.
Add a Selenocysteine tRNA family? -- see the tRNAscan-SE paper.
Ma J, Yan B, Qu Y, Qin F, Yang Y, Hao X, Yu J, Zhao Q, Zhu D, Ao G. (2008)
Zm401, a short-open reading-frame mRNA or noncoding RNA, is essential for tapetum and microspore development and can regulate the floret formation in maize.
VS ribozyme more recent
RNA article
HBV post-transcriptional regulatory element
mirTrons
1
2
3
FMR4: A Novel RNA Transcript with Antiapoptotic Function Is Silenced in Fragile X Syndrome
SRA1
PMID 16848684 (structured RNA in ORF?)
Alternative Splicing of the First Intron of the Steroid Receptor RNA Activator (SRA) Participates in the Generation of Coding and Noncoding RNA Isoforms in Breast Cancer Cell Lines
PMID 20219889
Expression Profiling Reveals Unexpected Targets and Functions of the Human Steroid Receptor RNA Activator (SRA) Gene.
VSRNA
A site-specific self-cleavage reaction performed by a novel RNA in neurospora mitochondria
Recoding in bacteriophages and bacterial IS elements
Evidence for Control of Splicing by Alternative RNA Secondary Structures in Dipteran Homothorax Pre-mRNA
Hairpin RNA: a secondary structure of primary importance
Bioinformatic and Physical Characterizations of Genome-Scale Ordered RNA Structure in Mammalian RNA Viruses
Ultra-conserved ncRNAs.
A source of new families?: Jia et al. (2007)
Systematic identification of non-coding RNA 2,2,7-trimethylguanosine cap structures in Caenorhabditis elegans. all snoRNA are done,wiki written and DESC completed for sRNAs but not all sRNAs have been finished io3
PVT1
GlmY Check this isn't the same as
GlmY_tke1 -- update wikipedia page...
HEPT3, PMID: 17611685 .
spc operon mRNA , structure is in
pdb id:1S03 . Seq: GGACGAUGGCGAAACUGCAUGAGGCAAUUCAUGCAAGUCCCUCGUCC
EMBL ID: X76506
S.cerevisiae small yeast inhibitor RNA isolated from total RNA.
RNA III:
13. Boisset S, Geissmann T, Huntzinger E, Fechter P, Bendridi N, Possedko M, Chevalier C, Helfer AC, Benito Y, Jacquier A, et al . (2007) Genes Dev 21:1353–1366.
14. Huntzinger E, Boisset S, Saveanu C, Benito Y, Geissmann T, Namane A, Lina G, Etienne J, Ehresmann B, Ehresmann C, et al . (2005) EMBO J 24:824 – 835.
15. Mor feldt E, Taylor D, von Gabain A, Ar v idson S (1995) EMBO J 14:4569 – 4577.
There are many apparent false-negatives for the 5S rRNA model. Needs fixed/checked.
Evolution of rDNA ITS1 and ITS2 sequences and RNA secondary structures within members of the fungal genera Grosmannia and Leptographium
Dictyostelium ncRNAs - see the email from Pontus Larsson.
De novo search for non-coding RNA genes in the AT-rich genome of Dictyostelium discoideum: Performance of Markov-dependent genome feature scoring
Small non-coding RNAs in Streptomyces coelicolor
Identification and Gene Disruption of Small Noncoding RNAs in Streptomyces griseus
Systematic identification and characterization of chicken (Gallus gallus) ncRNAs
PMID 10531319 Highly specific recognition of primer RNA structures for 2'-OH priming reaction by bacterial reverse transcriptases.
PMID 12459273 A partial copy of msDNA from a new retron element is likely a retrotransposed DNA found in the myxobacterium Nannocystis exedens.
???: new Rfams from Alex pmid:1687072
???: Apicomplexan/parasite snoRNA
attenuation
alex email new families 16/04/07
new rfams from sam email 2 emails=26/04/07
sam email snoRNA 25/05/07
RNA society meeting abstracts..
snRNA sam email 14/06/07
sam email 25/06/07 new family and expansion email
alex email 110707, HCV SL
done?
ANRIL
PMID 20956613
ANRIL, a long, noncoding RNA, is an unexpected major hotspot in GWAS.
PISRT1
PMID 16137905
Pisrt1, a gene implicated in XX sex reversal, is expressed in gonads of both sexes during mouse development
PMID 19543368
Disease-Causing 7.4 kb Cis-Regulatory Deletion Disrupting Conserved Non-Coding Sequences and Their Interaction with the FOXL2 Promotor: Implications for Mutation Screening
HGNC
PMID 20874843
Association of a novel long non-coding RNA in 8q24 with prostate cancer susceptibility.
PMID 20214974
Identification of Long stress-induced non-coding transcripts that have altered expression in cancer
NCRUPAR:
Entrez Gene
PMID 12084570
A noncoding RNA regulates human protease-activated receptor-1 gene during embryogenesis.
genecards
HGNC
RNCR2:
PMID 20459797
The long noncoding RNA RNCR2 directs mouse retinal cell specification.
TERRA:
PMID 17916692
Telomeric repeat containing RNA and RNA surveillance factors at mammalian chromosome ends.
PMID 20460456
The non-coding RNA TERRA is a natural ligand and direct inhibitor of human telomerase
B2 - PMID 20428794
A novel large regulator RNA, B2, partially overlaps the HEF1/NEDD9/Cas-L gene.
PRINS - Psoriasis Susceptibility-Related RNA Gene Induced by Stress
PMID 20377629
The anti-apoptotic protein G1P3 is overexpressed in psoriasis and regulated by the non-coding RNA, PRINS
PMID 15855153pfamdb1
GENBANK:
NR_023388
SONG from Zebrafinch genome paper:
The genome of a songbird
MHM ncRNA (Xist for birds...)
PMID 11321370
Transcripts of the MHM region on the chicken Z chromosome accumulate as non-coding RNA in the nucleus of female cells adjacent to the DMRT1 locus.
PMID 18489256
A bird's-eye view of sex chromosome dosage compensation.
PMID 17415708
Identification of a novel noncoding RNA gene, NAMA, that is downregulated in papillary thyroid carcinoma with BRAF mutation and associated with growth arrest
PMID 20214974
Identification of long stress-responsive non-coding transcripts that have altered expression in cancer
PMID 20129396
Identification, bioinformatic analysis and expression profiling of candidate mRNA-like non-coding RNAs in Sus scrofa
PMID 20137068
Long noncoding RNAs in neuronal-glial fate specification and oligodendrocyte lineage maturation
HULC:
PMID 17241883
Characterization of HULC, a Novel Gene With Striking Up-Regulation in Hepatocellular Carcinoma, as Noncoding RNA
PMID 20423907
CREB up-regulates long non-coding RNA, HULC expression through interaction with microRNA-372 in liver cancer.
HSR1:
Evidence for bacterial origin of heat shock RNA-1
Recurrent Focal Copy-Number Changes and Loss of Heterozygosity Implicate Two Noncoding RNAs and One Tumor Suppressor Gene at Chromosome 3q13.31 in Osteosarcoma: LOC285194 and BC040587
Prostate cancer antigen 3 (PCA3, also referred to as DD3) is a gene which has noncoding messenger RNA that is overexpressed in prostate cancer.
The iStem, a Long-Range RNA Secondary Structure Element Required for Efficient Exon Inclusion in the Drosophila Dscam Pre-mRNA
RNCR2 = MIAT = Gomafu
Tug1 :
New meaning in the message: Noncoding RNAs and their role in retinal development
Young TL, Matsuda T, Cepko CL. 2005. The noncoding RNA taurine upregulated gene 1 is required for differentiation of the murine retina. Curr Biol 15: 501-512.
fantom3:
Critical evaluation of the FANTOM3 non-coding RNA transcripts
HSR-omega or HSRw or ...
genbank seq
The Developmentally Active and Stress-inducible Non-coding hsr{omega} Gene is a Novel Regulator of Apoptosis in Drosophila
Sequence Evolution of the Drosophila Heat Shock Locus hsr{omega}. I. The Nonrepeated Portion of the Gene
Balanced gene regulation by an embryonic brain ncRNA is critical for adult hippocampal GABA circuitry.
EGO, a novel, noncoding RNA gene, regulates eosinophil granule protein transcript expression. At GenBank:
EGO
Finding noncoding RNA transcripts from low abundance expressed sequence tags -- ncR118 is crap! ncR8 looks good.
Discovery of functional elements in 12 Drosophila genomes using evolutionary signatures
Identification of putative noncoding polyadenylated transcripts in Drosophila melanogaster
Conserved introns reveal novel transcripts in Drosophila melanogaster
Detection of intergenic non-coding RNAs expressed in the main developmental stages in Drosophila melanogaster
Highly upregulated in liver cancer noncoding RNA is overexpressed in hepatic colorectal metastasis.
Identification and characterization of human non-coding RNAs with tissue-specific expression
Review:
The Genetic Signatures of Noncoding RNAs -- not BACE1-AS
GTL2 (also called MEG3), also mentioned in
plosone and
Experimental and Molecular Pathology
Maternally Expressed Gene 3 (MEG3) Noncoding Ribonucleic Acid: Isoform Structure, Expression, and Functions
chr14:100,353,498-100,405,840
PMID 20179190
Maternally Expressed Gene 3, an Imprinted Noncoding RNA Gene, Is Associated with Meningioma Pathogenesis and Progression
PMID 20392836
Increased Expression of Angiogenic Genes in the Brains of Mouse Meg3-Null Embryos.
Mico1 and Mico1os:
Novel imprinted transcripts from the Dlk1-Gtl2 intergenic region, Mico1 and Mico1os, show circadian oscillations.
Gomafu: Sone M, Hayashi T, Tarui H, Agata K, Takeichi M, Nakagawa S.
The mRNA-like noncoding RNA Gomafu constitutes a novel nuclear domain in a subset of neurons. J Cell Sci. 2007 Aug 1;120(Pt 15):2498-506.
lincRNAs: Guttman M, Amit I, Garber M, French C, Lin MF, Feldser D, Huarte M, Zuk O, Carey BW, Cassady JP, Cabili MN, Jaenisch R, Mikkelsen TS, Jacks T, Hacohen N, Bernstein BE, Kellis M, Regev A, Rinn JL, Lander ES. Chromatin signature reveals over a thousand highly conserved large non-coding RNAs in mammals. Nature. 2009 Mar 12;458(7235):223-7. Epub 2009 Feb 1.
ncRAN: Yu M, Ohira M, Li Y, Niizuma H, Oo ML, Zhu Y, Ozaki T, Isogai E, Nakamura Y, Koda T, Oba S, Yu B, Nakagawara A. High expression of ncRAN, a novel non-coding RNA mapped to chromosome 17q25.1, is associated with poor prognosis in neuroblastoma. Int J Oncol. 2009 Apr;34(4):931-8.
From OMIM: Chan, A. S.; Thorner, P. S.; Squire, J. A.; Zielenska, M. : Identification of a novel gene NCRMS on chromosome 12q21 with differential expression between Rhabdomyosarcoma subtypes. Oncogene 21: 3029-3037, 2002.
From OMIM: Liu, A. Y.; Torchia, B. S.; Migeon, B. R.; Siliciano, R. F. The human NTT gene: identification of a novel 17-kb noncoding nuclear RNA expressed in activated CD4+ T cells. Genomics 39: 171-184, 1997. PubMed ID : 9027504
SOX2OT
genbank
From OMIM: SOX2OT :: Fantes, J.; Ragge, N. K.; Lynch, S.-A.; McGill, N. I.; Collin, J. R. O.; Howard-Peebles, P. N.; Hayward, C.; Vivian, A. J.; Williamson, K.; van Heyningen, V.; FitzPatrick, D. R. Mutations in SOX2 cause anophthalmia. Nature Genet. 33: 461-462, 2003.
Complex architecture and regulated expression of the Sox2ot locus during vertebrate development.
Transcription of bxd noncoding RNAs promoted by trithorax represses Ubx in cis by transcriptional interference.
Imprinted noncoding RNAs
NRON RNA
Evf1:
Evf1 . Might be too long...
2-D Structure of the A Region of Xist RNA and Its Implication for PRC2 Association
Add structured elements from EvoFold and RNAz partially matching the Xist (hg17 chrX:72824515-72824578, chrX:72,833,900-72,834,200, chrX:72,853,300-72,853,450) and
AIR and H19 RNAs.
Xist and TSIX,
CTN
PINK
FMR4
Zm401
Kcnq1ot1
Kcnq1ot1 Antisense Noncoding RNA. 91 kb-long!!
Mohammad F, Pandey RR, Nagano T, Chakalova L, Mondal T, Fraser P and Kanduri C |title=Kcnq1ot1/Lit1 noncoding RNA mediates transcriptional silencing by targeting to the perinucleolar region |journal=Mol Cell Biol|volume=28 |issue=11 |pages=3713–28 |year=2008 |pmid=18299392 |url=http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Citation&list_uids=18299392 |doi=10.1128/MCB.02263-07
The long noncoding RNA Kcnq1ot1 organises a lineage-specific nuclear domain for epigenetic gene silencing
Complex organisation and structure of the ghrelin antisense strand gene GHRLOS, a candidate non-coding RNA gene.
NEAT1
Christine M. Clemson1, Corresponding Author Contact Information, E-mail The Corresponding Author, John N. Hutchinson2, Sergio A. Sara4, Alexander W. Ensminger2, 3, Archa H. Fox4, Andrew Chess2 and Jeanne B. Lawrence
An Architectural Role for a Nuclear Noncoding RNA: NEAT1 RNA Is Essential for the Structure of Paraspeckles.
Paraspeckles: nuclear bodies built on long noncoding RNA
Sasaki YT, Ideue T, Sano M, Mituyama T, Hirose T.
MENepsilon/beta noncoding RNAs are essential for structural integrity of nuclear paraspeckles. Proc Natl Acad Sci U S A. 2009 Feb 24;106(8):2525-30.
Sunwoo H, Dinger ME, Wilusz JE, Amaral PP, Mattick JS, Spector DL.
MEN varepsilon/beta nuclear-retained non-coding RNAs are up-regulated upon muscle differentiation and are essential components of paraspeckles. Genome Res. 2009 Mar;19(3):347-59.
NEAT2 aka MALAT1
PMID 20149803
Oxytocin stimulates expression of a noncoding RNA tumor marker in a human neuroblastoma cell line
genecards
A Plasmodium falciparum FcB1-schizont-EST collection providing clues to schizont specific genes structure and polymorphism -- could find overlaps with
Genome-wide discovery and verification of novel structured RNAs in Plasmodium falciparum
[
http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=ShowDetailView&TermToSearch=17604720&ordinalpos=1&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVDocSum HOTAIR. HOX ncRNAs. - no structured RNA components found in exon
Davis BM, Waldor MK.
RNase E-dependent processing stabilizes MicX, a Vibrio cholerae sRNA. Mol Microbiol. 2007 Jul;65(2):373-85. PMID: 17590231
emial from sam 15/11/07 PMID: 17590231 [PubMed - indexed for MEDLINE] RNase E-dependent processing stabilizes MicX, a Vibrio cholerae sRNA.
RNase E-dependent processing stabilizes MicX, a Vibrio cholerae sRNA Brigid M. Davis* and Matthew K. Waldor - WP page built
roX:
Also check out Jakob and Stefan's hits to drosophila roX1 and roX2, their predictions don't overlap but are flanking.
An Evolutionarily Conserved Domain of roX2 RNA Is Sufficient for Induction of H4-Lys16 Acetylation on the Drosophila X Chromosome done io3
Regulation of Histone H4 Lys16 Acetylation by Predicted Alternative Secondary Structures in roX Noncoding RNAs
Paul has a partial model for this (~pg5/Evf-2-5p): Evf2: (an alternatively spliced form of Evf-1)
Regionalization within the mammalian telencephalon is mediated by changes in responsiveness to Shh.
The Evf-2 noncoding RNA is transcribed from the Dlx-5/6 ultraconserved region and functions as a Dlx-2 transcriptional coactivator
Balanced gene regulation by an embryonic brain ncRNA is critical for adult hippocampal GABA circuitry
Evf2 is famous...
Published/In-press:
SmY
Yfr2 AKA
Cyano-1
Families of H/ACA ncRNA molecules in Trypanosomatids
GIR1 -- paul has an alignment somewhere for this, need a WP page.
influenza pseudoknot
ptaRNA1
RsaOG
From Paul's warehouse (/warehouse/pfam01/rfam/Users/pg5/data/rfam/new_families)
MicX (see refs below) - WP page built (MicX sRNA)
GABA3-editing
class_II_RNA - RF01571
pH-regulator
FourU
Lambda_thermo
ROSE_2
Evf-2-5p (see refs below)
Gabra-3 element (Marie Ohman and Jakob Petersen)
swap spliceosomal RNA models
miRbase UPDATED!
PseudoBase: suck all the knots out of here.
snoRNA:
snoRNAbase france downloaded
snoRNA:
yeast snoRNAdb downloaded
snoRNA:
Todd Lowe snoRNAdb downloaded
snoRNA:
plant snoRNAdb downloaded
snoRNA:
snoopy downloaded
snoRNA:
snoRNAbase
ncRNA:
lots DBs from NAR
CRISPR - Adam slurped most of these
crispr-database
crispi
RegulonDB
regRNA
Too Hard/Problematic/Junk
H-InvDB - weird interface
snoRNA:
Arabidopsis Small RNA Project - all miRNAs
HIGH PRIORIY: RNA antitoxins
Add hok and sok utr element from RDF's book (Transcription Regulation in Prokaryotes)!
RNA antitoxins -- An RNA antitoxin from an Enterococcus faecalis plasmid
An antisense RNA controls synthesis of an SOS-induced toxin evolved from an antitoxin
Wikipedia page for IstR -
link
PMID 20156992
Abundance of type I toxin–antitoxin systems in bacteria: searches for new candidates and discovery of novel families
An antisense RNA controls synthesis of an SOS-induced toxin evolved from an antitoxin
High priority: PMID 20453032
Recognition and discrimination of target mRNAs by Sib RNAs, a cis-encoded sRNA family
High priority: HSURs (Herpesvirus saimiri U RNAs), EBERS, PAN RNA
PMID 17381320
The challenge of viral snRNPs.
PMID 15916956
Small Nuclear RNAs Encoded by Herpesvirus saimiri Upregulate the Expression of Genes Linked to T Cell Activation in Virally Transformed T Cells
HSUR 1 and 2 are the most conserved of all HSURs and are shown to associate with host miRNAs in virally transformed cells.
HIGH PRIORIY: FnrS
Reprogramming of Anaerobic Metabolism by the FnrS Small RNA
Translational regulation of gene expression by an anaerobically induced small non-coding RNA in Escherichia coli
HIGH PRIORITY:
Intergenic transcription is required to repress the Saccharomyces cerevisiae SER3 gene -- grab srg1 seq from
genbank
HIGH PRIORITY:
Analysis of small RNA in fission yeast; centromeric siRNAs are potentially generated through a structured RNA
HIGH PRIORIY:
A pH-responsive riboregulator
Paul is building this one...
HIGH PRIORITY:
A variant riboswitch aptamer class for S-adenosylmethionine common in marine bacteria - failed
Identification of small RNAs in Mycobacterium tuberculosis
HIGH PRIORITY: Missing some of these: -- check the names are consistent with table 1 :
Homologs of Small Nucleolar RNAs in Archaea
HIGH PRIORITY:
Identification of candidate structured RNAs in the marine organism 'Candidatus Pelagibacter ubique'. -- another beautiful article from the Breaker lab!
HIGH PRIORITY:
The Genome Sequence of Taurine Cattle: A Window to Ruminant Biology and Evolution
sequence
profile - no obvious conserved non-coding region
HIGH PRIORIY:
Omer et al. Archael snoRNAs.
HIGH PRIORITY: Laura A. Kavanaugh, Fred S. Dietrich
Non-Coding RNA Prediction and Verification in Saccharomyces cerevisiae
HIGH PRIORIY: dos Santos G, Simmonds AJ, Krause HM.
A stem-loop structure in the wingless transcript defines a consensus motif for apical RNA transport Development. 2008 Jan;135(1):133-43. Epub 2007 Nov 28. - RF01046
SprD -- High priority:
PMID 20532214
A Staphylococcus aureus Small RNA Is Required for Bacterial Virulence and Regulates the Expression of an Immune-Evasion Molecule
PMID 16183745
Small RNA genes expressed from Staphylococcus aureus genomic and pathogenicity islands with specific expression among pathogenic strains -- NB. Check Erratum.
HIGH PRIORIY:
A search for small noncoding RNAs in Staphylococcus aureus reveals a conserved sequence motif for regulation
High priority: PMID 20489016
Adaptive Evolution of an sRNA That Controls Myxococcus Development
HIGH PRIORIY:
The Non-coding RNA gadd7 Is a Regulator of Lipid-induced Oxidative and Endoplasmic Reticulum Stress
Genbank: Cricetulus longicaudatus gadd7 mRNA
HIGH PRIORIY:
Exceptional structured noncoding RNAs revealed by bacterial metagenome analysis
See the email submission from Zasha
RNAs_present_in_environmental_samples -- moved up to the RNA Biol. articles.
HIGH PRIORIY: PMID 20349053
Nematode sbRNAs: Homologs of Vertebrate Y RNAs
HIGH PRIORIY: PMID 19098893
A stress-responsive RNA switch regulates VEGFA expression low complexity
HIGH PRIORITY:
The cspA mRNA Is a Thermosensor that Modulates Translation of the Cold-Shock Protein CspA
RNA Switches Out in the Cold
PMID 20233932
Interactions of the RNA-binding protein, Hfq, with cspA mRNA encoding the major cold-shock protein
HIGH PRIORIY: MicX: (Paul has been working on a seed for this...feel free to write the Wikipedia page tho! ;-)
Drosophila Wingless RNA structural element. overlap io3
The 3′ end of Turnip crinkle virus contains a highly interactive structure including a translational enhancer that is disrupted by binding to the RNA-dependent RNA polymerase overlap io3
Identification of in vivo interaction between Hepatitis C Virus core protein and 5' and 3' UTR RNA. overlap io3
A tymovirus with an atypical 3′-UTR illuminates the possibilities for 3′-UTR evolution overlap io3
The Listeria transcriptional landscape from saprophytism to virulence done io3
Expression and Processing of a Small Nucleolar RNA from the Epstein-Barr Virus Genome v-snoRNA sequence:
[EMBL:FN376861 +-newId FN376861] done io3
Novel non-coding RNAs in Dictyostelium discoideum and their expression during development done io3
Transcripts of unknown function in multiple-signaling pathways involved in human stem cell differentiation pg5 -- no apparent conservation, no structure
Multiple posttranscriptional regulatory mechanisms partner to control ethanolamine utilization in Enterococcus faecalis done io3
Guo L, Allen EM, and Miller WA Base-pairing between untranslated regions facilitates translation of uncapped, nonpolyadenylated viral RNA. Mol Cell 2001; 7(5), 1103-9 done io3
Suess B, Fink B, Berens C, Stentz R, Hillen W. A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Res. 2004 Mar 5;32(4):1610-4. Print 2004. synthetic io3
Apical Loop-Internal Loop RNA Pseudoknots: A NEW TYPE OF STIMULATOR OF-1 TRANSLATIONAL FRAMESHIFTING IN BACTERIA Mazauric et al. done io3
A manganese-dependent ribozyme in the 3'-untranslated region of Xenopus Vg1 mRNA done io3
The structure of NoRC-associated RNA is crucial for targeting the chromatin remodelling complex NoRC to the nucleolus done io3
RNA secondary structures located in the interchromosomal region of human ACAT1 chimeric mRNA are required to produce the 56-kDa isoform done io3
McMullan et al. Evidence for a functional RNA element in the hepatitis C virus core gene overlap io3
Small non-coding RNAs in Caulobacter crescentus done io3
Gilly Padalon-Brauch, Ruth Hershberg, Maya Elgrably-Weiss, Kobi Baruch, Ilan Rosenshine, Hanah Margalit and Shoshy Altuvia (2008)
Small RNAs encoded within genetic islands of Salmonella typhimurium show host-induced expression and role in virulence pg
Aspergillus ncRNAs done io3
Identification of 17 Pseudomonas aeruginosa sRNAs and prediction of sRNA-encoding genes in 10 diverse pathogens using the bioinformatic tool sRNAPredict2 done io3
'Giardia intestinalis'
ncRNA candidates. rubbish io3
sam email 10/08/07 pmid=17621584
An Evolutionarily Conserved Domain of roX2 RNA Is Sufficient for Induction of H4-Lys16 Acetylation on the Drosophila X Chromosome. done io3
From alex: glmUS operon pmid=17854828, Vogel August 2007 overlap io3
Guanine riboswitch variants from Mesoplasma florum done io3
Structural RNAs of known and unknown function identified in malaria parasites by comparative genomics and RNA analysis. done io3
Small RNA-induced differential degradation of the polycistronic mRNA iscRSUA done io3
A conserved small RNA promotes silencing of the outer membrane protein YbfM overlap io3
emial alex: 05/11/07 Proc Natl Acad Sci U S A. 2006 Dec 19;103(51):19490-5. Epub 2006 Dec 12.
new families alex email 120707 from zasha.weinberg@yale.edu. See
publication.
new ribozyme families? 15029187 16141078
RF00206 human U54 taken out of family. need metazoan family built.
miRNA Rfmas to be rebuilt.
RNAallostery ref 16826230 TPP and SAM sensors?
piRNA to go in? pmid 16751777 no proof of conservation -- no structure -- short
Translation Initiation from the Ribosomal A Site or the P Site, Dependent on the Conformation of RNA Pseudoknot I in Dicistrovirus RNAs overlap io3
The Trypanosomatid Signal Recognition Particle Consists of Two RNA Molecules, a 7SL RNA Homologue and a Novel tRNA-like Molecule can't build io3
Host-dependent roles of the viral 5′ untranslated region (UTR) in RNA stabilization and cap-independent translational enhancement mediated by the 3′ UTR of Red clover necrotic mosaic virus RNA1 done io3
The Listeria transcriptional landscape from saprophytism to virulence done io3
An internal antisense RNA regulates expression of the photosynthesis gene isiA io3
The Listeria transcriptional landscape from saprophytism to virulence duplicate entry
Identification of new noncoding RNAs in Listeria monocytogenes and prediction of mRNA targets done io3
A Highly Structured, Nuclease-Resistant, Noncoding RNA Produced by Flaviviruses Is Required for Pathogenicity done by io3
Identification and Functional Analysis of 20 Box H/ACA Small Nucleolar RNAs (snoRNAs) from Schizosaccharomyces pombe done io3
Mining small RNA sequencing data: a new approach to identify small nucleolar RNAs in Arabidopsis io3
A novel sRNA that modulates virulence and environmental fitness of Vibrio cholerae done io3
Prakash Chandra Mishra, Anuj Kumar and Amit Sharma (2009)
Analysis of small nucleolar RNAs reveals unique genetic features in malaria parasites done io3
Jason E. Weil, Michalis Hadjithomas, and Karen L. Beemon
Structural Characterization of the Rous Sarcoma Virus RNA Stability Element. done by io3
The Hfq-Dependent Small Non-Coding (s) RNA NrrF Directly Mediates Fur-Dependent Positive Regulation of Succinate Dehydrogenase in Neisseria meningitidis. Metruccio MM, Fantappiè L, Serruto D, Muzzi A, Roncarati D, Donati C, Scarlato V, Delany I. J Bacteriol. 2008 Dec 5.
A small non-coding RNA of the invasion gene island (SPI-1) represses outer membrane protein synthesis from the Salmonella core genome. Verena Pfeiffer, Alexandra Sittka, Raju Tomer, Karsten Tedin, Volker Brinkmann and Jörg Vogel
Evidence of a novel RNA secondary structure in the coding region of HIV-1 pol gene. Qi Wang1,2, Ian Barr1,3, Feng Guo1,3, and Christopher Lee. RNA (2008), 14:1–11. done by io3
BS190, BS201 in Bacillus
SurA, SurC, polC-ylxS in Bacillus
RatA in Bacillus
SR1 in Bacillus
Novel small RNA-encoding genes in the intergenic regions of Bacillus subtilis. Saito S, Kakeshita H, Nakamura K.
Identification of conserved secondary structures and expansion segments in enod40 RNAs reveals new enod40 homologues in plants Alexander P. Gultyaev and Andreas Roussis
Terminal structures of West Nile virus genomic RNA and their interactions with viral NS5 protein Hongping Donga, Bo Zhanga and Pei-Yong Shi
Isolation and characterization of RNA aptamers specific for the HCV minus-IRES domain I. Nucleic Acids Symp Ser (Oxf). 2008; 493-4 Konno K, Fujita S, Iizuka M, Nishikawa S, Hasegawa T, Fukuda K overlap io3
An internal antisense RNA regulates expression of the photosynthesis gene isiA IsrR (iron stress-repressed RNA) duplicated
ADAM LOOKING AT
Small CRISPR RNAs Guide Antiviral Defense in Prokaryotes tan J. J. Brouns,1* Matthijs M. Jore,1* Magnus Lundgren,1 Edze R. Westra,1 Rik J. H. Slijkhuis,1 Ambrosius P. L. Snijders,2 Mark J. Dickman,2 Kira S. Makarova,3 Eugene V. Koonin,3 John van der Oost
An RNA Sensor for Intracellular Mg2+ (2006) Cromie MJ, Shi Y, Latifi T, Groisman EA.
NMR-Assisted Prediction of RNA Secondary Structure: Identification of a Probable Pseudoknot in the Coding Region of an R2 Retrotransposon
PAUL IS WORKING ON THIS ONE:
Expression of a noncoding RNA is elevated in Alzheimer's disease and drives rapid feed-forward regulation of bold beta-secretase
Structural Domains Within the 3' UTR of Turnip Crinkle Virus
MOCO Riboswitch: Regulski EE, Moy RH, Weinberg Z, Barrick JE, Yao Z, Ruzzo WL, Breaker RR. (2008) A widespread riboswitch candidate that controls bacterial genes involved in molybdenum cofactor and tungsten cofactor metabolism.
SAH riboswitch email from Joy Wang. ~pg5/new_families/SAH
Send RNA Biology invite when HACA paper is accepted:
Elucidating the Role of C/D snoRNA in rRNA Processing and Modification in Trypanosoma brucei
IstR-1 sRNA (Vogel pmid 17499044 ) ?
3'UTR ergulatory element of DNA polymerase Beta mRNA . done io3
Y RNAs! Split the family up into Y1, Y2, Y3 and Y5? Best to wait until a sequence update has been done so we capture
Stadler and
Perreault results.
Add a separate model for the D. radioduraans Y RNA.
Add more metazoan/invertebrate MRP/RNase P sequences from
Piccinelli, Rosenblad and Samuelsson.
NAR article.
rethreshold RF00582 (current is too low).
Use local for the U3? Find it in S. cerevisiae.
A new 7SK model from this
article .
Y RNAs - caution Peter Stadler may rebuild the model ,
U7
Sam is building fungal models of spliceosomal RNAs
need models for U4atac, U6atac, U11, Rox1, Rox2
HGNC naming HACA rfams missing? (ACA3 ACA6 U107 ACA16 U98b ACA23 ACA31 ACA34 ACA36 ACA37 ACA39 ACA3-2 HBI-115 ACA59 ACA60 U17/E1 ACA62 ACA63 ACA64 ACA65 ACA67 HBI-61)
Hugo naming CD rfams HBII-115 U55 HBII-202 U74 U75 U76 U80 U84 HBII-251 HBII-180 HBII-296 HBII-316 HBII-336 U94 U96 U97 HBII-419 HBII-420 HBII-429 U104 HBII-436 HBII- 437 HBII-438 HBII-55 HBII-82 14q
multiple Rfams=U25 U43 U102: Enrico set name change / check out.
cajal body families froom the HGMC list (also U85 pmid 11157760
new rfams from alex 29/01/07 2 papers DONE16990549 and DONE 15565159 DONE plus sgsR 17209026
new family from sam 20/03/07
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=17299041&dopt=AbstractPlus
new rfam pubcrawler email 25/02/07 pmid=17307818 B2_SINE (looked into this...repeats)
#NO HOMOLOGS:
group III catalytic introns
Pyrococcus abyssi (Archaea) H/ACA box snoRNAs . See email from Fabrice Leclerc.