The invertebrate mitochondrial code ( translation table 5) is a genetic code used by the mitochondrial genome of invertebrates. Mitochondria contain their own DNA and reproduce independently from their host cell. Variation in translation of the mitochondrial genetic code occurs when DNA codons result in non-standard amino acids has been identified in invertebrates, most notably arthropods. [1] This variation has been helpful as a tool to improve upon the phylogenetic tree of invertebrates, like flatworms. [2]
The code
AAs = FFLLSSSSYY**CCWWLLLLPPPPHHQQRRRRIIMMTTTTNNKKSSSSVVVVAAAADDEEGGGGStarts = ---M----------------------------MMMM---------------M------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V).
Differences from the standard code
| DNA codons | RNA codons | This code (5) | Standard code (1) | |
|---|---|---|---|---|
| AGA | AGA | Ser (S) | Arg (R) | |
| AGG | AGG | Ser (S) | Arg (R) | |
| ATA | AUA | Met (M) | Ile (I) | |
| TGA | UGA | Trp (W) | STOP = Ter (*) |
Note: The codon AGG is absent in Drosophila. [3]
Alternative initiation codons
- ATA/AUA
- ATT/AUU
- ATC/AUC: Apis [4]
- GTG/GUG: Polyplacophora [5]
- TTG/UUG: Ascaris, Caenorhabditis.
Systematic range
- Nematoda: Ascaris, Caenorhabditis ;
- Mollusca: Bivalvia); [6] Polyplacophora; [5]
- Arthropoda/ Crustacea: Artemia; [7]
- Arthropoda/ Insecta: Drosophila [ Locusta migratoria (migratory locust), Apis mellifera (honeybee)].
Other variations
- Several arthropods translate the codon AGG as lysine instead of serine (as in the Pterobranchia Mitochondrial Code) or arginine (as in the standard genetic code). [8] [9]
- GUG may possibly function as an initiator in Drosophila. [10] [11] AUU is not used as an initiator in Mytilus [6]
- "An exceptional mechanism must operate for initiation of translation of the cytochrome oxidase subunit I mRNA in both D. melanogaster [12] and D. yakuba, [13] since its only plausible initiation codon, AUA, is out of frame with the rest of the gene. Initiation appears to require the "reading" of an AUAA quadruplet, which would be equivalent to initiation at AUA followed immediately by a specific ribosomal frameshift. Another possible mechanism ... is that the mRNA is "edited" to bring the AUA initiation into frame." [14]
See also
References
This article incorporates text from the United States National Library of Medicine, which is in the public domain. [15]
- ^ Abascal, Federico; Posada, David; Knight, Robin D.; Zardoya, Rafael (25 April 2006). "Parallel Evolution of the Genetic Code in Arthropod Mitochondrial Genomes". PLOS Biology. 4 (5): e127. doi: 10.1371/journal.pbio.0040127. ISSN 1545-7885. PMC 1440934. PMID 16620150.
- ^ Telford, Maximilian J.; Herniou, Elisabeth A.; Russell, Robert B.; Littlewood, D. Timothy J. (10 October 2000). "Changes in mitochondrial genetic codes as phylogenetic characters: Two examples from the flatworms". Proceedings of the National Academy of Sciences. 97 (21): 11359–11364. doi: 10.1073/pnas.97.21.11359. ISSN 0027-8424. PMC 17205. PMID 11027335.
- ^ Sengupta S, Yang X, Higgs PG (June 2007). "The mechanisms of codon reassignments in mitochondrial genetic codes". Journal of Molecular Evolution. 64 (6): 662–88. arXiv: q-bio/0703066. Bibcode: 2007JMolE..64..662S. doi: 10.1007/s00239-006-0284-7. PMC 1894752. PMID 17541678.
- ^ Crozier RH, Crozier YC (January 1993). "The mitochondrial genome of the honeybee Apis mellifera: complete sequence and genome organization". Genetics. 133 (1): 97–117. doi: 10.1093/genetics/133.1.97. PMC 1205303. PMID 8417993.
- ^ a b Boore JL, Brown WM (October 1994). "Complete DNA sequence of the mitochondrial genome of the black chiton, Katharina tunicata". Genetics. 138 (2): 423–43. doi: 10.1093/genetics/138.2.423. PMC 1206160. PMID 7828825.
- ^ a b Hoffmann RJ, Boore JL, Brown WM (June 1992). "A novel mitochondrial genome organization for the blue mussel, Mytilus edulis". Genetics. 131 (2): 397–412. doi: 10.1093/genetics/131.2.397. PMC 1205014. PMID 1386586.
- ^ Batuecas B, Garesse R, Calleja M, Valverde JR, Marco R (July 1988). "Genome organization of Artemia mitochondrial DNA". Nucleic Acids Research. 16 (14A): 6515–29. doi: 10.1093/nar/16.14.6515. PMC 338311. PMID 3135541.
- ^ Abascal F, Posada D, Knight RD, Zardoya R (May 2006). "Parallel evolution of the genetic code in arthropod mitochondrial genomes". PLOS Biology. 4 (5): e127. doi: 10.1371/journal.pbio.0040127. PMC 1440934. PMID 16620150.
- ^ Robinson, Richard (25 April 2006). "For Arthropod Mitochondria, Variety in the Genetic Code Is Standard". PLOS Biology. 4 (5): e175. doi: 10.1371/journal.pbio.0040175. PMC 1440929. PMID 20076581.
- ^ Clary DO, Wolstenholme DR (1985). "The mitochondrial DNA molecular of Drosophila yakuba: nucleotide sequence, gene organization, and genetic code". Journal of Molecular Evolution. 22 (3): 252–71. Bibcode: 1985JMolE..22..252C. doi: 10.1007/BF02099755. PMID 3001325. S2CID 12384495.
- ^ Gadaleta G, Pepe G, De Candia G, Quagliariello C, Sbisà E, Saccone C (July 1988). "Nucleotide sequence of rat mitochondrial NADH dehydrogenase subunit 1. GTG, a new initiator codon in vertebrate mitochondrial genome". Nucleic Acids Research. 16 (13): 6233. doi: 10.1093/nar/16.13.6233. PMC 336868. PMID 3399396.
- ^ de Bruijn MH (1983). "Drosophila melanogaster mitochondrial DNA, a novel organization and genetic code". Nature. 304 (5923): 234–41. Bibcode: 1983Natur.304..234D. doi: 10.1038/304234a0. PMID 6408489. S2CID 35948584.
- ^ Clary DO, Wolstenholme DR (June 1983). "Nucleotide sequence of a segment of Drosophila mitochondrial DNA that contains the genes for cytochrome c oxidase subunits II and III and ATPase subunit 6". Nucleic Acids Research. 11 (12): 4211–27. doi: 10.1093/nar/11.12.4211. PMC 326036. PMID 6306579.
- ^ Fox TD (1987). "Natural variation in the genetic code". Annual Review of Genetics. 21: 67–91. doi: 10.1146/annurev.ge.21.120187.000435. PMID 3327473.
- ^ Elzanowski A, Ostell J, Leipe D, Soussov V. "The Genetic Codes". Taxonomy browser. National Center for Biotechnology Information (NCBI), U.S. National Library of Medicine. Retrieved 26 August 2015.
 | This microbiology-related article is a stub. You can help Wikipedia by expanding it. |
The invertebrate mitochondrial code ( translation table 5) is a genetic code used by the mitochondrial genome of invertebrates. Mitochondria contain their own DNA and reproduce independently from their host cell. Variation in translation of the mitochondrial genetic code occurs when DNA codons result in non-standard amino acids has been identified in invertebrates, most notably arthropods. [1] This variation has been helpful as a tool to improve upon the phylogenetic tree of invertebrates, like flatworms. [2]
The code
AAs = FFLLSSSSYY**CCWWLLLLPPPPHHQQRRRRIIMMTTTTNNKKSSSSVVVVAAAADDEEGGGGStarts = ---M----------------------------MMMM---------------M------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V).
Differences from the standard code
| DNA codons | RNA codons | This code (5) | Standard code (1) | |
|---|---|---|---|---|
| AGA | AGA | Ser (S) | Arg (R) | |
| AGG | AGG | Ser (S) | Arg (R) | |
| ATA | AUA | Met (M) | Ile (I) | |
| TGA | UGA | Trp (W) | STOP = Ter (*) |
Note: The codon AGG is absent in Drosophila. [3]
Alternative initiation codons
- ATA/AUA
- ATT/AUU
- ATC/AUC: Apis [4]
- GTG/GUG: Polyplacophora [5]
- TTG/UUG: Ascaris, Caenorhabditis.
Systematic range
- Nematoda: Ascaris, Caenorhabditis ;
- Mollusca: Bivalvia); [6] Polyplacophora; [5]
- Arthropoda/ Crustacea: Artemia; [7]
- Arthropoda/ Insecta: Drosophila [ Locusta migratoria (migratory locust), Apis mellifera (honeybee)].
Other variations
- Several arthropods translate the codon AGG as lysine instead of serine (as in the Pterobranchia Mitochondrial Code) or arginine (as in the standard genetic code). [8] [9]
- GUG may possibly function as an initiator in Drosophila. [10] [11] AUU is not used as an initiator in Mytilus [6]
- "An exceptional mechanism must operate for initiation of translation of the cytochrome oxidase subunit I mRNA in both D. melanogaster [12] and D. yakuba, [13] since its only plausible initiation codon, AUA, is out of frame with the rest of the gene. Initiation appears to require the "reading" of an AUAA quadruplet, which would be equivalent to initiation at AUA followed immediately by a specific ribosomal frameshift. Another possible mechanism ... is that the mRNA is "edited" to bring the AUA initiation into frame." [14]
See also
References
This article incorporates text from the United States National Library of Medicine, which is in the public domain. [15]
- ^ Abascal, Federico; Posada, David; Knight, Robin D.; Zardoya, Rafael (25 April 2006). "Parallel Evolution of the Genetic Code in Arthropod Mitochondrial Genomes". PLOS Biology. 4 (5): e127. doi: 10.1371/journal.pbio.0040127. ISSN 1545-7885. PMC 1440934. PMID 16620150.
- ^ Telford, Maximilian J.; Herniou, Elisabeth A.; Russell, Robert B.; Littlewood, D. Timothy J. (10 October 2000). "Changes in mitochondrial genetic codes as phylogenetic characters: Two examples from the flatworms". Proceedings of the National Academy of Sciences. 97 (21): 11359–11364. doi: 10.1073/pnas.97.21.11359. ISSN 0027-8424. PMC 17205. PMID 11027335.
- ^ Sengupta S, Yang X, Higgs PG (June 2007). "The mechanisms of codon reassignments in mitochondrial genetic codes". Journal of Molecular Evolution. 64 (6): 662–88. arXiv: q-bio/0703066. Bibcode: 2007JMolE..64..662S. doi: 10.1007/s00239-006-0284-7. PMC 1894752. PMID 17541678.
- ^ Crozier RH, Crozier YC (January 1993). "The mitochondrial genome of the honeybee Apis mellifera: complete sequence and genome organization". Genetics. 133 (1): 97–117. doi: 10.1093/genetics/133.1.97. PMC 1205303. PMID 8417993.
- ^ a b Boore JL, Brown WM (October 1994). "Complete DNA sequence of the mitochondrial genome of the black chiton, Katharina tunicata". Genetics. 138 (2): 423–43. doi: 10.1093/genetics/138.2.423. PMC 1206160. PMID 7828825.
- ^ a b Hoffmann RJ, Boore JL, Brown WM (June 1992). "A novel mitochondrial genome organization for the blue mussel, Mytilus edulis". Genetics. 131 (2): 397–412. doi: 10.1093/genetics/131.2.397. PMC 1205014. PMID 1386586.
- ^ Batuecas B, Garesse R, Calleja M, Valverde JR, Marco R (July 1988). "Genome organization of Artemia mitochondrial DNA". Nucleic Acids Research. 16 (14A): 6515–29. doi: 10.1093/nar/16.14.6515. PMC 338311. PMID 3135541.
- ^ Abascal F, Posada D, Knight RD, Zardoya R (May 2006). "Parallel evolution of the genetic code in arthropod mitochondrial genomes". PLOS Biology. 4 (5): e127. doi: 10.1371/journal.pbio.0040127. PMC 1440934. PMID 16620150.
- ^ Robinson, Richard (25 April 2006). "For Arthropod Mitochondria, Variety in the Genetic Code Is Standard". PLOS Biology. 4 (5): e175. doi: 10.1371/journal.pbio.0040175. PMC 1440929. PMID 20076581.
- ^ Clary DO, Wolstenholme DR (1985). "The mitochondrial DNA molecular of Drosophila yakuba: nucleotide sequence, gene organization, and genetic code". Journal of Molecular Evolution. 22 (3): 252–71. Bibcode: 1985JMolE..22..252C. doi: 10.1007/BF02099755. PMID 3001325. S2CID 12384495.
- ^ Gadaleta G, Pepe G, De Candia G, Quagliariello C, Sbisà E, Saccone C (July 1988). "Nucleotide sequence of rat mitochondrial NADH dehydrogenase subunit 1. GTG, a new initiator codon in vertebrate mitochondrial genome". Nucleic Acids Research. 16 (13): 6233. doi: 10.1093/nar/16.13.6233. PMC 336868. PMID 3399396.
- ^ de Bruijn MH (1983). "Drosophila melanogaster mitochondrial DNA, a novel organization and genetic code". Nature. 304 (5923): 234–41. Bibcode: 1983Natur.304..234D. doi: 10.1038/304234a0. PMID 6408489. S2CID 35948584.
- ^ Clary DO, Wolstenholme DR (June 1983). "Nucleotide sequence of a segment of Drosophila mitochondrial DNA that contains the genes for cytochrome c oxidase subunits II and III and ATPase subunit 6". Nucleic Acids Research. 11 (12): 4211–27. doi: 10.1093/nar/11.12.4211. PMC 326036. PMID 6306579.
- ^ Fox TD (1987). "Natural variation in the genetic code". Annual Review of Genetics. 21: 67–91. doi: 10.1146/annurev.ge.21.120187.000435. PMID 3327473.
- ^ Elzanowski A, Ostell J, Leipe D, Soussov V. "The Genetic Codes". Taxonomy browser. National Center for Biotechnology Information (NCBI), U.S. National Library of Medicine. Retrieved 26 August 2015.
|
| This microbiology-related article is a stub. You can help Wikipedia by expanding it. |